Synthetic Gene DataBase
 

Synthetic Gene 170


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID157170
GenBank AccessionU76545
GenBank GI1667548
Gene NamexynBsynthetic xynB
Gene Length (bp)10830
SpeciesDictyoglomus thermophilumTrichoderma reesei
StrainsRt46B.1HEP1
CDSatgtttcttaaaaaacttagtaagttgctcttagtcgtactacttgtcgcagtgtatacg
caagttaatgctcaaacgtctataacactaacaagtaatgcaagcggtacttttgatggc
tactactatgaactatggaaagatacagggaatacaaccatgactgtatacacacaagga
aggtttagctgtcagtggagcaatataaacaatgcattattcagaacaggtaagaagtac
aaccaaaactggcagtcattaggcactattagaatcacctactcagccacatataatcct
aatggtaactcctacttatgtatctatggttggtctactaatcctttagtagagttttac
attgtagaaagttggggtaattggcgtccaccaggtgcaacctctcttggacaggttact
atcgacggtggtacctatgacatttacagaactacccgtgtaaatcagccatctattgtc
ggtacagctacttttgatcaatattggagtgtaaggacatctaagagaacaagtggaaca
gtcactgtaacagatcactttagggcatgggcaaatagaggtttaaaccttggtactatt
gatcaaattactctttgtgttgaaggatatcaaagcagtggttcggctaatataacacaa
aatactttttctcaaggtagcagtagtggaagtagtgggggcagtagtggtagtacaaca
actactagaatagaatgtgaaaacatgtcattaagtgggccctatgtatcaagaattaca
aatccatttaatggtatagctctttatgcaaatggagatactgcaagagctacagtaaac
ttcccagcaagtcgtaactataatttcaggttaagaggatgcggaaataacaataattta
gctcgggttgatttacgaatagatgggaggactgtaggtacgttctattatcagggaaca
tatccttgggaggctcctatagacaatgtatacgtgagtgcaggttctcatacagtggaa
attacagttacggctgataatgggacatgggatgtttatgcagattatctggtgatacag
taa
5' End
3' End
NotesCDS for the natural gene was taken from the NBCI databased using references cited in the article.
Expression VectorpHEN11pHEN11 (with cbh1 promoter), pHEN42 (with a mature cellobiohydrolase I protein)
Assay MethodsNorthern BlotNorthern Blot
ResultsNo expressionSignificant increase (3 of 16 pHEN42 transformants, 2 of 3 pHEN11 transformants)
Protein FunctionHydrolyzes xylan
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon optimized based on the codon usage patterns of highly expressed T. reesei genes. 20 codons
total were changed.
Publication Author(s)Te'o, V. S.; Cziferszky, A. E.; Bergquist, P. L.; Nevalainen, K. M.
Corresponding AuthorK.M. Helena Nevalainen
Corresponding AddressDepartment of Biological Sciences, Macquarie University, Sydney, NSW, Australia.
Publication Year2000
Publication TitleCodon optimization of xylanase gene xynB from the thermophilic bacterium Dictyoglomus thermophilum for expression in the filamentous fungus Trichoderma reesei
AbstractThe catalytic domain of the xynB (xylanase) gene from the thermophilic bacterium Dictyoglomus thermophilum was reconstructed by PCR to match the codon preference of Trichoderma reesei. The 0.6-kb DNA fragment encoding the enzyme was first amplified by primer extension with a mixture of eight overlapping oligonucleotides, followed by PCR with outside primers containing restriction enzyme sites for directional cloning into Escherichia coli and T. reesei vectors. The synthetic gene was expressed in both organisms, producing a clearing halo around transformant colonies in plate assay utilizing an overlay of oat spelts xylan. Effective transcription of xyn B in T. reesei was obtained after changing 20 codons.
JournalFEMS Microbiol Lett. 190(1): 13-9.
SummaryTrichoderma reesei was transformed with a recoded version of the xynB gene, synthetic xynB, in order to increase the expression of the xylasnase enzyme. The natural gene was codon optimized based on the codon usage patterns of Trichoderma reesei. The natural gene did not produce any mRNA and as a result, no protein. Synthetic xynB produced mRNA and protein in about a quarter of the transformants. Overall, the recoding did not perform well, but was not a total failure.
CommentsThere was no specific test for the protein amount, but rather the mRNA levels, which in turn are related to the actual amount of protein which could be made. Author was e-mailed for CDS on 1/25/2006, but no reply was received after two weeks
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=566
PubMed ID10981683
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site