Synthetic Gene DataBase
 

Synthetic Gene 171


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID158171
GenBank AccessionA15660
GenBank GI490037
Gene Namethasynthetic tha
Gene Length (bp)6210
SpeciesThaumatococcus danielliiAspergillus awamori
StrainsATCC22342lpr66
CDSgccaccttcgagatcgtcaaccgctgctcctacaccgtgtgggcggccgcctccaaaggc
gacgccgccctcgacgccggcggccgccagctcaactcgggagagtcctggaccatcaac
gtagaacccggcaccaagggtggcaaaatctgggcccgcaccgactgctatttcgacgac
agcggccgcggcatctgccggaccggcgactgcggcggcctcctccagtgcaagcgcttc
ggccggccgcccaccacgctggcggagttctcgctcaaccagtacggcaaggactacatc
gacatctccaacatcaaaggcttcaacgtgccgatggacttcagcccgaccacgcgcggc
tgccgcggggtgcggtgcgccgccgacatcgtggggcagtgcccggcgaagctgaaggcg
ccggggggtggttgcaacgatgcgtgcaccgtgttccagacgagcgagtactgctgcacc
acggggaagtgcgggccgacggagtactcgcgcttcttcaagaggctttgcccggacgcg
ttcagttatgtcctggacaagccaaccaccgtcacctgccccggcagctccaactacagg
gtcactttctgccctactgcc
5' End
3' End
Notes
Expression Vector
Assay MethodsWestern Blot, ELISAWestern Blot, ELISA
ResultsSignificant amount (5-15 mg/L)High increase (80-105mg/L, promoters increased production by a small amount)
Protein FunctionSweetner in human food and feed additive.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe natural gene was codon optimized based on the codon usage patterns of A. awamori. Some
transformants were fused with either a cahB promoter or a gdhA promoter.
Publication Author(s)Moralejo, F. J.; Cardoza, R. E.; Gutierrez, S.; Sisniega, H.; Faus, I.; Martin, J. F.
Corresponding AuthorJ.F. Martin
Corresponding AddressInstitute of Biotechnology INBIOTEC, Science Park of Leon, Spain.
Publication Year2000
Publication TitleOverexpression and lack of degradation of thaumatin in an aspergillopepsin A-defective mutant of Aspergillus awamori containing an insertion in the pepA gene
AbstractA gene encoding the sweet-tasting protein thaumatin (tha) with optimized codon usage was expressed in Aspergillus awamori. Mutants of A. awamori with reduced proteolytic activity were isolated. One of these mutants, named lpr66, contained an insertion of about 200 bp in the pepA gene, resulting in an inactive aspergillopepsin A. In vitro thaumatin degradation tests confirmed that culture broths of mutant lpr66 showed only a small thaumatin-degrading activity. A. awamori lpr66 has been used as host strain for thaumatin expression cassettes containing the tha gene under the control of either the cahB (cephalosporin acetylhydrolase) promoter of Acremonium chrysogenum or the gdhA (glutamate dehydrogenase) promoter of Aspergillus awamori. Residual proteolytic activities were repressed by using a mixture of glucose and sucrose as carbon sources and L-asparagine as nitrogen source. Degradation of thaumatin by acidic proteases was prevented by maintaining the pH value at 6.2 in the fermentor. Expression of cassettes containing the gdhA promoter was optimal in ammonium sulfate as nitrogen source, whereas transformants expressing the tha gene from the cahB promoter yielded higher thaumatin levels using L-asparagine as nitrogen source. Under optimal fermentation conditions, yields of 105 mg thaumatin/l were obtained, thus making this fermentation a process of industrial interest.
JournalAppl Microbiol Biotechnol. 54(6): 772-7.
SummaryAspergillus awamori was transformed with a recoded version of the tha gene, synthetic tha, in order to increase the expression of the protein, thaumatin. tha was codon optimized based on the codon usage patterns of Aspergillus awamori. The natural gene, tha, did not produced a smaller, yet significant amount of protein, whereas the synthetic tha produced a much higher amount as expected and from this it can be concluded that the recoding of the natural gene was very successful for its intended purpose of increasing protein expression.
CommentsCDS of recoded gene and natural gene was not provided by the article. The CDS for the natural gene was taken from the NBCI database. The expression vectors were not provided in the article as well. The corresponding author was e-mailed on 1/26/2006 for the CDS and vector, but no reply was received after 2 weeks.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=565
PubMed ID11152068
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site