Synthetic Gene DataBase
 

Synthetic Gene 172


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID142172
GenBank AccessionE09431.1
GenBank GI22026058
Gene NamehG-CSFFopt5
Gene Length (bp)525525
SpeciesHomo sapiensEscherichia coli
StrainsN/ABL21 (DE3)
CDSacccccctgggccctgccagctccctgccccagagcttcctgctcaagtgcttagagcaa
gtgaggaagatccagggcgatggcgcagcgctccaggagaagctgtgtgccacctacaag
ctgtgccaccccgaggagctggtgctgctcggacactctctgggcatcccctgggctccc
ctgagcagctgccccagccaggccctgcagctggcaggctgcttgagccaactccatagc
ggccttttcctctaccaggggctcctgcaggccctggaagggatctcccccgagttgggt
cccaccttggacacactgcagctggacgtcgccgactttgccaccaccatctggcagcag
atggaagaactgggaatggcccctgccctgcagcccacccagggtgccatgccggccttc
gcctctgctttccagcgccgggcaggaggggtcctagttgcctcccatctgcagagcttc
ctggaggtgtcgtaccgcgttctacgccaccttgcccagccctga
5' End
3' End
NotesThis sequence may not be the full CDS, however it is the most likely sequence found in GenBank.We are currently awaiting correspondence from the author about the optimized gene sequence.
Expression VectorpCytexThetaHpET3a, pET19b
Assay MethodsSDS-PAGESDS-PAGE
ResultsThe natural gene produced sub-optimal concentration of hG-CSF when inserted into E. coli.The recoded gene gave high yield of hG-CSF protein, much higher than the natural gene, as was hypothesized.
Protein FunctionStimulates the proliferation, differentiation, and function of neutrophil granulocyte progenitor cells and mature neutrophils.
Recoding PurposeTo improve expression
Synthesized ByAuthors (PCR synthesis)
Recoding MethodThe recoding method was obtained by expression system E. coli DH5-alpha based on strong tandem
promoters from bacteriophage lambda.
Publication Author(s)Jevsevar, S.; Gaberc-Porekar, V.; Fonda, I.; Podobnik, B.; Grdadolnik, J.; Menart, V.
Corresponding AuthorSimona Jevsevar
Corresponding AddressLek Pharmaceuticals d.d., Verovskova 57, SI-1000 Ljubljana, Slovenia. simona.jevsevar@ki.si
Publication Year2005
Publication TitleProduction of nonclassical inclusion bodies from which correctly folded protein can be extracted
AbstractHuman granulocyte-colony stimulating factor (hG-CSF), an important biopharmaceutical drug used in oncology, is currently produced mainly in Escherichia coli. Expression of human hG-CSF gene in E. coli is very low, and therefore a semisynthetic, codon-optimized hG-CSF gene was designed and subcloned into pET expression plasmids. This led to a yield of over 50% of the total cellular proteins. We designed a new approach to biosynthesis at low temperature, enabling the formation of ""nonclassical"" inclusion bodies from which correctly folded protein can be readily extracted by nondenaturing solvents, such as mild detergents or low concentrations of polar solvents such as DMSO and nondetergent sulfobetaines. FT-IR analysis confirmed different nature of inclusion bodies with respect to the growth temperature and indicated presence of high amounts of very likely correctly folded reduced hG-CSF in nonclassical inclusion bodies. The yield of correctly folded, functional hG-CSF obtained in this way exceeded 40% of the total hG-CSF produced in the cells and is almost completely extractable under nondenaturing conditions. The absence of the need to include a denaturation/renaturation step in the purification process allows the development of more efficient processes characterized by higher yields and lower costs and involving environment-friendly technologies. The technology presented works successfully at the 50-L scale, producing nonclassical inclusion bodies of the same quality. The approach developed for the production of hG-CSF could be extended to other proteins; thus, a broader potential for industrial exploitation is envisaged.
JournalBiotechnol Prog. 21(2): 632-9.
SummaryThe goal of this study was to not only recode the human granulocyte-colony stimulating factor (hG-CSF) for optimal expression in E. coli, but also then to make use of the advantages of inclusion body formation while avoiding the requirement for a denaturation/renaturation step. The gene was optimized for E. coli expression and then the protein was expressed at low temperature, which resulted in the production of readily solubilized "nonclassical" inclusion bodies containing a large amount of correctly folded reduced protein.
CommentsWe are currently awaiting correspondence from this author regarding the recoded gene sequence.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=661#661
PubMed ID15801811
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site