Synthetic Gene DataBase
 

Synthetic Gene 173


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID99173
GenBank AccessionAL844506 REGION: 1093527..1094637
GenBank GI23498713
Gene NamePfEMP1PfEMP1
Gene Length (bp)11111111
SpeciesPlasmodium falciparumEscherichia coli
StrainsFCR3S1.2BL21-CodonPlus-RIL
CDSttaatcttcctcctcctcgtcttcactagtattttcgtcttcttcacttgaattttcgtc
atcttcatcacttgtattataatcatcatcatcacttgaaattccatcatgtttatctaa
taattcttctaaacgtttttcttcatcacctccgataactaaaatttctccttgttgttt
aaaatcacctcctttatattctttgattttatcacttataactttcatagcttcttgaat
ttttgccataccaagatctttatcatgacaagacgtaacaataacatattgtggtggagc
aattaattttatattaatagaaactttatcattcgatatctcttttccttttttcagagc
ttccttaacagcatcaataccttcatatccaaaacaccatacatctattctacctcttaa
ttttaatgcttgaggagtaagtcttaatttaatatcttttaataatgaattttttatttc
ttcagatatatctaaccctttaaatacattttctggattcatcgtagcttctttcaacgc
atctaaagcatgtccatatctttcatataatggccatatagctttttcgtttagctcttc
tacagtaatgccatgttcttttgctacatgtcgcacagtctggtgcacctttttagattt
agaaaatttttcttcacattttattatatcttttggtgatactctcctttttgataaatc
gatatatcctttttggctatctactcttaatacaagtacaacctcatgcctacctacacg
tattaatttgttcacacttctgaatcttcttttggatagttcggacattaaaatcatacc
ttcacaaggagccagggggggtggataagaaaaaaataaaaaataaataatatatataaa
atatgtataaattttttttattttttttttttttttttctttttttttaaaatttattac
cttccatatcgttatattccaatatagaaacgtaagctcccatatcctcaattctattaa
ccttaaccataatcaaatcatcaacctcgggaaacttctttttataaaaacgacagtccc
ccaaatctgcttttactcgcatttcagtcat
5' End
3' End
NotesWe are currently waiting on correspondence from the author pertaining to the recoded gene sequence.
Expression VectorpGEXpGEX4T-1
Assay MethodsSDS-PAGESDS-PAGE
ResultsThe natural gene was not expressed in this experiment, however previous research has shown that the natural gene is poorly expressed in E. coli.The recoding of the gene seemingly had little or no effect on the amount or quality of expression of the protein, contrary to the hypothesis that the amount and/or quality would increase.
Protein FunctionErythrocyte membrane constitutional protein 1
Recoding PurposeTo improve expression
Synthesized ByAuthors (PCR synthesis)
Recoding MethodThe recoding method was not explained in this paper specifically, but the GeneArt program was used
to re-synthesize it.
Publication Author(s)Flick, K.; Ahuja, S.; Chene, A.; Bejarano, M. T.; Chen, Q.
Corresponding AuthorQijun Chen
Corresponding AddressMicrobiology and Tumor Biology Centre (MTC), Karolinska Institutet, Stockholm, Sweden. Kirsten.Flick@smi.ki.se
Publication Year2004
Publication TitleOptimized expression of Plasmodium falciparum erythrocyte membrane protein 1 domains in Escherichia coli
AbstractBACKGROUND: The expression of recombinant proteins in Escherichia coli is an important and frequently used tool within malaria research, however, this method remains problematic. High A/T versus C/G content and frequent lysine and arginine repeats in the Plasmodium falciparum genome are thought to be the main reason for early termination in the mRNA translation process. Therefore, the majority of P. falciparum derived recombinant proteins is expressed only as truncated forms or appears as insoluble inclusion bodies within the bacterial cells. METHODS: Several domains of PfEMP1 genes obtained from different P. falciparum strains were expressed in E. coli as GST-fusion proteins. Expression was carried out under various culture conditions with a main focus on the time point of induction in relation to the bacterial growth stage. RESULTS AND CONCLUSIONS: When expressed in E. coli recombinant proteins derived from P. falciparum sequences are often truncated and tend to aggregate what in turn leads to the formation of insoluble inclusion bodies. The analysis of various factors influencing the expression revealed that the time point of induction plays a key role in successful expression of A/T rich sequences into their native conformation. Contrary to recommended procedures, initiation of expression at post-log instead of mid-log growth phase generated significantly increased amounts of soluble protein of a high quality. Furthermore, these proteins were shown to be functionally active. Other factors such as temperature, pH, bacterial proteases or the codon optimization for E. coli had little or no effect on the quality of the recombinant protein, nevertheless, optimizing these factors might be beneficial for each individual construct. In conclusion, changing the timepoint of induction and conducting expression at the post-log stage where the bacteria have entered a decelerated growth phase, greatly facilitates and improves the expression of sequences containing rare codons.
JournalMalar J. 3(1): 50.
SummaryThe goal of this study was to improve the expression of P. falciparum erythrocyte membrane protein I domains in E. coli by optimizing codon usage and by initiating expression at post-log instead of mid-log growth phase. After transforming BL21-CodonPlus-RIL strain E. coli with the optimized gene, the integrity and amount of the protein generated was much higher, but this was found to be a product of the initiation during post-log growth phase, whereas the optimization of codons had little to no effect.
CommentsWe are currently waiting for correspondence from the author pertaining to the recoded gene sequence.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=668#668
PubMed ID15601471
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site