Synthetic Gene DataBase
 

Synthetic Gene 174


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID159174
GenBank AccessionD78338.1
GenBank GI2116689
Gene NameRH1RH1
Gene Length (bp)819819
SpeciesDactylosporangium sp.Escherichia coli
StrainsNot specifiedW1485 putA
CDSatgctgaccccgacggagctcaagcagtaccgcgaggcgggctatctgctcatcgaggac
ggcctcggcccgcgggaggtcgactgcctgcgccgggcggcggcggccctctacgcgcag
gactcgccggaccgcacgctggagaaggacggccgcaccgtgcgcgcggtccacggctgc
caccggcgcgacccggtctgccgcgacctggtccgccacccgcgcctgctgggcccggcg
atgcagatcctgtccggcgacgtgtacgtccaccagttcaagatcaacgcgaaggccccg
atgaccggcgatgtctggccgtggcaccaggactacatcttctgggcccgagaggacggc
atggaccgtccgcacgtggtcaacgtcgcggtcctgctcgacgaggccacccacctcaac
gggccgctgttgttcgtgccgggcacccacgagctgggcctcatcgacgtggagcgccgc
gcgccggccggcgacggcgacgcgcagtggctgccgcagctcagcgccgacctcgactac
gccatcgacgccgacctgctggcccggctgacggccgggcggggcatcgagtcggccacc
ggcccggcgggctcgatcctgctgttcgactcccggatcgtgcacggctcgggcacgaac
atgtcgccgcacccgcgcggcgtcgtcctggtcacctacaaccgcaccgacaacgccctg
ccggcgcaggccgctccgcgcccggagttcctggccgcccgcgacgccaccccgctggtg
ccgctgcccgcgggcttcgcgctggcccagcccgtctag
5' End
3' End
NotesWe are currently waiting on correspondence from the author pertaining to the recoded gene sequence.
Expression VectorN/ApWFH1
Assay MethodsN/ANot specified
ResultsThe natural gene was not expressed in this experiment, but previous studies have shown that it yields low concentration of protein when inserted into E. coli.The recoded gene yielded a very high concentration of protein, whereas the natural gene yielded zero production of protein.
Protein FunctionUseful chiral synthon for the chemical syntheses of pharmaceuticals.
Recoding PurposeTo improve expression
Synthesized ByAuthors (PCR synthesis)
Recoding MethodThe recoding method was not explained in the paper.
Publication Author(s)Shibasaki, T.; Mori, H.; Ozaki, A.
Corresponding AuthorTakeshi Shibaseki
Corresponding AddressTokyo Research Laboratories, Kyowa Hakko Kogyo Co., Ltd, Machida, Japan.
Publication Year2000
Publication TitleEnzymatic production of trans-4-hydroxy-L-proline by regio- and stereospecific hydroxylation of L-proline
AbstractA proline 4-hydroxylase gene, which was cloned from Dactylosporangium sp. RH1, was overexpressed in Escherichia coli W1485 on a plasmid under a tryptophan tandem promoter after the codon usage of the 5' end of the gene was optimized. The proline 4-hydroxylase activity was l600-fold higher than that in Dactylosporangium sp. RH1. trans-4-Hydroxy-L-proline(Hyp) was produced and accumulated to 41 g/L (87% yield from L-proline) in 100 h when the recombinant E. coli was cultivated in a medium containing L-proline and glucose. 2-Oxoglutarate, which is necessary for the hydroxylation of L-proline by proline 4-hydroxylase, was apparently supplied from glucose through the cellular metabolic pathway. The putA mutant of W1485, which is not able to degrade L-proline, has allowed the quantitative conversion of L-proline to Hyp. The formation of other isomers of hydroxyproline was not observed. Productivity of Hyp was almost the same in a larger-scale culture. The method of manufacturing Hyp from L-proline was established.
JournalBiosci Biotechnol Biochem. 64(4): 746-50.
SummaryThe goal of this experiment was to optimize the RH1 gene from Dactylosporangium sp. to be expressed in E. coli. The recoded gene was cloned into the plasmid pWFH1 and transformed into the E. coli cells and was expressed at a much higher rate than the natural gene.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=671#671
PubMed ID10830487
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site