Synthetic Gene DataBase
 

Synthetic Gene 175


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID160175
GenBank AccessionM28816.1AF087957.1
GenBank GI1524693834578
Gene NameTlcTlc
Gene Length (bp)14971497
SpeciesRickettsia prowazekiiEscherichia Coli
StrainsNot specifiedBL21(DE3)
CDSatgagtacttccaaaagtgaaaattatctttcagaactaagaaagataatttggcctata
gaacaatatgaaaataagaagtttttgccacttgcatttatgatgttctgtattttatta
aactactcaactcttcgttcaattaaagacggttttgtagtaacagatataggtacagaa
tcgataagttttttaaaaacatatatagtactaccttctgctgtaattgctatgataatt
tatgttaagctatgtgatattttaaagcaagaaaacgtattttatgttattacttcattt
tttttagggtattttgcattatttgcctttgttctttacccatatcctgatttagtccac
cctgatcataaaactatagaatctttaagtttagcttatcctaatttcaaatggtttata
aaaatagttggtaaatggagttttgcatctttttatactattgccgagctttggggaaca
atgatgcttagtttattattttggcaatttgctaatcaaattactaaaatcgctgaagct
aaacgtttctactcaatgtttggtttacttgcgaatttagcattgcctgtaacatcagtg
gttattggatattttctacacgaaaaaactcaaatagttgcagaacatttaaaatttgta
cctttatttgttataatgataacaagtagtttcttaataatattaacatatagatggatg
aataaaaatgttctaactgatcctagactatatgatccagcattagtaaaagaaaaaaaa
actaaagctaaattgtcgttcatagaaagtttaaaaatgatctttacttcgaaatatgta
ggttatattgcattattaattattgcttatggtgtttcagtaaatttagttgaaggtgtt
tggaaatccaaagtaaaagaattatatccgacaaaggaggcttataccatatatatgggt
cagttccaattttatcagggttgggttgcaattgcttttatgctgataggtagtaatatt
ttaagaaaagtatcatggctaactgcagctatgatcactccattaatgatgttcataaca
ggtgcggcatttttttcatttatattttttgatagcgttattgcaatgaatttaaccggc
atccttgcttcaagtcctttaacacttgctgttatgatcggtatgattcaaaatgtttta
agtaaaggtgtgaaatattctttatttgatgcaactaaaaatatggcgtatattccactt
gataaggatttacgagtcaaagggcaagctgccgttgaagttatcggaggaaggctcggt
aaatcaggcggtgctattattcaatctacattctttattttatttcctgtatttggtttt
atagaggcgactccttattttgcttctatattctttataatagtaatattatggatattt
gcagttaaaggtttaaataaagagtatcaagttttggtaaataaaaatgaaaaatag
atgtctacttccaaatctgaaaactacctgtctgaactgcgtaaaatcatctggccgatc
gaacagtacgaaaacaaaaaattcctgccgctggctttcatgatgttctgcatcctgctg
aactactctactctgcgttctatcaaagacggtttcgttgttaccgatatcggtaccgaa
tctatctctttcctgaaaacctacatcgttctgccgtctgctgttatcgctatgatcatc
tacgttaaactgtgcgacatcctgaaacaggaaaacgtattctacgttatcacttctttc
ttcctgggttacttcgctctgttcgctttcgttctgtacccgtacccggacctggttcac
ccggaccacaaaactatcgaaagcttgtctctggcttacccgaacttcaaatggttcatc
aaaatcgttggtaaatggtctttcgcttctttctacactatcgctgaactgtggggcacc
atgatgctgtctctgctgttctggcagttcgctaaccagatcactaaaatcgctgaagct
aaacgtttctactctatgttcggtctgctggccaacctggctctgccggttacctctgtt
gttatcggttacttcctgcacgaaaaaactcagatcgttgctgaacaccttaagttcgtt
ccgctgttcgttatcatgatcacctcttctttcctgatcatcctgacctaccgttggatg
aacaaaaacgttctgactgacccgcgtctgtacgacccggctctggttaaagaaaaaaaa
actaaagctaaactgtctttcatcgaatctctgaaaatgatcttcactagtaaatacgtt
ggttacatcgctctgctgatcatcgcttacggtgtttctgttaacctggttgaaggtgtt
tggaaatctaaagttaaagaactgtacccgaccaaagaggcctacaccatctacatgggt
cagttccagttctaccagggttgggtcgctatcgctttcatgctgatcggttctaacatc
ctgcgtaaagtttcttggctgactgcagctatgatcactccgctgatgatgttcatcacc
ggtgctgctttcttctctttcatcttcttcgactctgttatcgcgatgaacctgaccggc
atcctggcttcttctccgctgaccctggctgttatgatcggtatgatccagaacgttctg
tctaaaggtgttaaatactctctgttcgacgctactaaaaacatggcttacatcccgctg
gacaaagacctgcgtgttaaaggtcaggccgcggttgaagttatcggtggtcgtctgggt
aaatctggcggtgctatcatccagtctaccttcttcatcctgttcccggttttcggtttc
atcgaagctactccgtacttcgcttctatcttcttcatcatcgttatcctgtggatcttc
gctgttaaaggtctgaacaaagaataccaggttctggttaacaaaaacgaaaaatga
5' End
3' End
Notes
Expression VectorpT7-5pT7-5
Assay MethodsWestern BlotWestern Blot
ResultsThe expression rate of the natural gene was not very high in E. coli.The experssion of the natural gene and the recoded gene were shown to be similar, so the recoding did not strongly affect the expression of the gene until the expression vector was changed to pT7-5, at which time the expression rose significantly.
Protein FunctionTransports ATP into the R. prowazekii cell from the cytoplasm of the host cell.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe actual recoding method was not explained, but to the recoded gene, a C-terminus tag consisting
of 10 consecutive histidine residues preceeded by the Ecl136II restriction site and followed by a
translation termination codon was introduced, and the NdeI site at the 5' end of the gene was
replaced with BamHI site.
Publication Author(s)Alexeyev, M. F.; Winkler, H. H.
Corresponding AuthorHerbert Winkler
Corresponding AddressLaboratory of Molecular Biology, Department of Microbiology and Immunology, University of South Alabama College of Medicine, Mobile, AL 36688, USA.
Publication Year1999
Publication TitleGene synthesis, bacterial expression and purification of the Rickettsia prowazekii ATP/ADP translocase
AbstractThe Rickettsia prowazekii ATP/ADP translocase (Tlc) is the first member of a new family of ATP/ADP exchangers that includes both prokaryotic and eukaryotic proteins. We optimized the codon usage for expression of tlc in Escherichia coli by means of gene synthesis, expressed the synthetic gene in E. coli, and purified a modified Tlc that contained a C-terminal tag of 10 consecutive histidine residues by immobilized metal affinity chromatography. Although codon usage in R. prowazekii is very different from E. coli, the optimization of the codon usage by itself was insufficient to improve expression. However, the change of the cloning vector from pET11a to pT7-5 led to a 3-10-fold increase in the specific ATP transport rate by cells expressing the synthetic construct. The authenticity of the purified protein was confirmed by N-terminal amino acid sequencing and a matrix assisted laser desorption/ionization mass spectrometry.
JournalBiochim Biophys Acta. 1419(2): 299-306.
SummaryThe goal of this study was to optimize the R. prowazekii ATP/ADP translocase gene for overexpression in E. coli. The recoded gene was cloned into a pET11a vector and transformed into BL21(DE3) strain E. coli. Western blot analysis showed no real increase in protein expression, suggesting that the gene expression was not hindered by codon usage, but by some other factor.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=590
PubMed ID10407080
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site