Synthetic Gene DataBase
 

Synthetic Gene 176


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID161176
GenBank AccessionNM_058197.2
GenBank GI47132607
Gene NameMTS1MTS1
Gene Length (bp)351351
SpeciesHomo sapiensEscherichia coli
StrainsNot specifiedBL21 (DE3)
CDSatggagccggcggcggggagcagcatggagccttcggctgactggctggccacggccgcg
gcccggggtcgggtagaggaggtgcgggcgctgctggaggcgggggcgctgcccaacgca
ccgaatagttacggtcggaggccgatccaggtgggtagaaggtctgcagcgggagcaggg
gatggcgggcgactctggaggacgaagtttgcaggggaattggaatcaggtagcgcttcg
attctccggaaaaaggggaggcttcctggggagttttcagaaggggtttgtaatcacaga
cctcctcctggcgacgccctgggggcttgggaaaccaaggaagaggaatga
5' End
3' End
NotesWe are currently waiting on correspondence from the author pertaining to the recoded gene sequence.
Expression VectorpET21apET21a
Assay MethodsSDS-PAGEELISA
ResultsThe natural gene was not expressed in this experiment, but previous studies have shown that it shows very low expression in E. coli.The expression of the recoded gene reached 22% total protein product, compared with only 13% from the natural gene.
Protein FunctionEncodes a protein called p16, which inhibits CDK4/6 in humans.
Recoding PurposeTo improve expression
Synthesized ByAuthors (PCR synthesis)
Recoding MethodThe exact recoding method was not specified in the paper.
Publication Author(s)Yang, B.; Guo, Z.; Huang, Y.; Zhu, S.
Corresponding AuthorShenggeng Zhu
Corresponding AddressCollege of Life Sciences, Peking University, Beijing 100871, PR China.
Publication Year2004
Publication TitleCodon optimization of MTS1 and its expression in Escherichia coli
AbstractMTS1, which encodes a protein named p16, is an important gene involved in tumorigenesis. To increase the expression of p16 in Escherichia coli, MTS1 was synthesized de novo by recursive PCR, with codons optimized towards E. coli. Studies indicate that N-terminal amino acids of p16 had negative impact on its expression in E. coli. The function of p16DeltaN8 is not affected by the absence of N-terminal eight amino acids, compared with p16. p16DeltaN8 was expressed in E. coli, which reached 22% of total cell proteins. Purified p16DeltaN8 (purity was 98%) was delivered into A875 (melanoma), MCF7 (breast cancer), and HeLa (cervical cancer) cells by lipofectin. Results show purified p16DeltaN8 remarkably inhibited the growth of A875 and MCF7 cells, whereas it had little effect on HeLa cells.
JournalProtein Expr Purif. 36(2): 307-11.
SummaryThe goal of this study was to increase expression of p16 protein in E. coli, so that the protein can be used in treatment of cancers to stunt growth of cancer cells. The recoded gene was cloned into pET21a vector and transformed into BL21 (DE3) strain E. coli cells. The protein expression rose from 13% total protein content to 22%. This increase was not enormous, but supports the hypothesis that the gene would be expressed more strongly when it included the codons more often used in E. coli.
CommentsWe are currently awaiting correspondence from the author pertaining to the recoded gene sequence.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=665#665
PubMed ID15249054
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site