Synthetic Gene DataBase
 

Synthetic Gene 177


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID162177
GenBank AccessionX04693.1
GenBank GI21266
Gene NameSoPCGSOPCG
Gene Length (bp)507507
SpeciesSpinacia oleraceaEscherichia coli
StrainsNot MentionedBL21 (DE3)
CDSatggccaccgtcgcttcctccgctgccgtagccgtcccctcctttaccggccttaaggcc
tcaggatccatcaagcctaccaccgcaaaaatcatcccaaccaccaccgccgtcccaaga
ttgtctgtcaaggcttccttgaagaatgtcggagccgccgtggtagcaaccgcagccgcc
ggacttctagccggaaacgccatggccgttgaggtgttgctcggagggggtgacggatca
ttggcattccttccaggagacttcagcgtagcctcgggcgaggagatcgtattcaagaac
aatgccggattcccccacaacgtagtgtttgacgaggacgagattccctccggtgtcgac
gccgcgaagatttcgatgtccgaggaggatttgctgaatgcaccaggggaaacttacaaa
gttacccttactgagaaaggaacttacaagttctactgctcaccccaccagggtgctggt
atggtgggaaaagtaactgtcaactaa
5' End
3' End
NotesWe are currently awaiting correspondence from the author regarding the recoded gene sequence.
Expression VectorN/ApME223
Assay MethodsN/AEPR Spectroscopy
ResultsThe natural gene was not expressed in this study, but prior studies have shown that the expression rate is low in E. coli.The recoded gene was expressed much more strongly than the natural gene, with a protein product concentration of 38 mg/L.
Protein FunctionSmall blue copper protein which transfers electrons from the cytochrome bdf complex to photosystem 1.
Recoding PurposeTo improve expression
Synthesized ByAuthors (PCR synthesis)
Recoding MethodThe recoding method was not specified in the paper.
Publication Author(s)Ejdeback, M.; Young, S.; Samuelsson, A.; Karlsson, B. G.
Corresponding AuthorB. Goran Karlsson
Corresponding AddressDepartment of Biochemistry and Biophysics, Goteborg University, Sweden.
Publication Year1997
Publication TitleEffects of codon usage and vector-host combinations on the expression of spinach plastocyanin in Escherichia coli
AbstractSpinach plastocyanin has been expressed in Escherichia coli and exported to the periplasmic space. The effects of codon usage, expression system, growth length, and temperature on expression levels in LB medium were investigated. A stretch of codons, rare in E. coli, was identified and replaced with highly expressed codons, increasing the yield by at least 20%. Plastocyanin was more efficiently expressed under the T7 promoter than under the lac promoter. Maximum yields were obtained at 37 degrees C when growing the cells for 16 h after induction. The optimized expression system produced 38 mg holoprotein per liter culture. In this system it was also possible to express plastocyanin in minimal medium, at a yield of 10 mg per liter. N-terminal sequencing and mass spectrometry showed that plastocyanin was correctly processed. The expressed plastocyanin was purified to homogeneity, as shown by an A278/A597 ratio of 1.0, and together with amino acid analysis and the determination of oxidized and total copper contents, both the absorption coefficients for epsilon 278 and for epsilon 597 were determined to be 4700 M-1 cm-1.
JournalProtein Expr Purif. 11(1): 17-25.
SummaryThe goal of this study was to optimize the spinach plastocyanin gene for expression in E. coli, so that it could be studied more easily. The plastid pME223 was transformed into BL21 (DE3) strain E. coli cells, and the protein was expressed strongly, at 38 mg/L protein concentration.
CommentsWe are currently awaiting correspondence from the author regarding the recoded gene sequence.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=672#672
PubMed ID9325134
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site