Synthetic Gene DataBase
 

Synthetic Gene 178


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID163178
GenBank AccessionNC_001664.1
GenBank GI9628290
Gene NameU51U51-CO
Gene Length (bp)906948
SpeciesHuman herpesvirus 6Homo sapiens
StrainsWT U51HEK293A
CDSatggagaaagaaacgaagtctttggcttggccagccactgcggagttttatggttgggta
tttattttttcgtccatacagttgtgtacaatggttttactgacggttaggtttaatagt
tttaaagtcggtcgagaatacgctgtgtttacatttgccgggatgagctttaattgtttt
ttacttccgataaagatgggattgttgagtggacattggtctttgccgcgagatttttgc
gcaattcttctctacatcgatgatttttctatctatttctcctcgtggtcattggtgttt
atggcgatcgagcgcatcaaccacttctgttacagcacaccgttgttgaacgagaattcc
aaggctctggcaaaggtgtgtttcccgatagtttggatcatatcgggagtgcaagctctt
cagatgctgaataattacaaagcaacagctttgcagaacgagaccccacagtgttttctc
gcgttcttaaggagcggatacgacatgtggttaatgttggtttattcggtcatgattcca
gttatgctggtgtttatttacatatacagcaaaaatttcatgcttttgaaagatgaactt
tcgaccgtgactacgtatctctgtatttatttgctgctaggtacaatagcgcatctgccg
aaagctggcttaagtgaaatcgagagtgacaagattttttatggtttgcgcgatattttt
atggcgcttcctgttttaaaagtttattatatacccgttatggcctattgcatggcatgt
gatgatcacactgtgcccgttcgtttgtgtagtatctggctggtcaatttgtgtaagaaa
tgtttttcgtgtacgcggcgcgaaaaggagtcggatttagaggttggaataaaaatgtta
aaatga
atggagtacccctacgacgtgcccgactacgccggaggcggcagcaaggagaccaagagc
ctggcctggcccgccaccgccgagttctacggctgggtgttcatcttcagcagcatccag
ctgtgcaccatggtgctgctgaccgtgcggttcaacagcttcaaggtgggccgggagtac
gccgtgttcaccttcgccggcatgagcttcaactgcttcctgctgcccatcaagatgggc
ctgctgagcggccactggagcctgccccgggacttctgcgccatcctgctgtacatcgac
gacttcagcatctacttcagcagctggagcctggtgttcatggccatcgagcggatcaac
cacttctgctacagcacccccctgctgaacgagaacagcaaggccctggccaaggtgtgc
ttccccatcgtgtggatcatcagcggcgtgcaggccctgcagatgctgaacaactacaag
gccaccgccctgcagaatgagaccccccagtgcttcctggccttcctgcggagcggctac
gacatgtggctgatgctggtgtacagcgtgatgatccccgtgatgctggtgttcatctac
atctacagcaagaacttcatgctgctgaaggacgagctgagcaccgtgaccacctacctg
tgcatctacctgctgctgggcaccatcgcccacctgcccaaggccggcctgagcgagatc
gagagcgacaagatcttctacggcctgcgggacatcttcatggccctgcccgtgctgaag
gtgtactacatccccgtgatggcctactgcatggcctgcgacgaccacaccgtgcccgtg
cggctgtgcagcatctggctggtgaacctgtgcaagaagtgcttcagctgcacccggagg
gagaaggagagcgacctggaggtgggcatcaagatgctgaagtaatga
5' Endtctagaggtaccgccacc
3' Endtatcgcatgc
NotesThe region of the genome which is the CDS for U51 includes nucleotides 82574..83479.
Expression VectorpPCRScriptpcDNA3
Assay MethodsSDS-PAGESDS-PAGE
ResultsThe natural gene was expressed in human cells, but with very low protein concentration shown.The recoded gene gave rise to relatively high concentration of protein product in the HEK293A strain human cells.
Protein Function7-tm receptor homologous to cellular opioid receptors
Recoding PurposeTo improve expression
Synthesized ByAuthors (PCR synthesis)
Recoding MethodThe recoding method was not explicitly stated in this paper.
Publication Author(s)Bradel-Tretheway, B. G.; Zhen, Z.; Dewhurst, S.
Corresponding AuthorStephen Dewhurst
Corresponding AddressDepartment of Microbiology and Immunology, University of Rochester Medical Center, 601 Elmwood Avenue, Box 672, Rochester, NY 14642, USA.
Publication Year2003
Publication TitleEffects of codon-optimization on protein expression by the human herpesvirus 6 and 7 U51 open reading frame
AbstractCodon-optimization refers to the alteration of gene sequences, to make codon usage match the available tRNA pool within the cell/species of interest. Codon-optimization has emerged as a powerful tool to increase protein expression by genes from small RNA and DNA viruses, which commonly contain overlapping reading frames as well as structural elements that are embedded within coding regions; these features are not widespread among large DNA viruses. We therefore examined whether codon-optimization might influence protein expression from a herpesvirus gene. We focused on the U51 gene from human herpesviruses-6 and -7, which was cloned in both native and codon-optimized form, with an N-terminal HA epitope tag to allow protein detection. Codon-optimization was associated with a profound (10-100 fold) increase in U51 expression in human (293A, HSG, K562) or hamster (CHO) cell lines, suggesting this may represent a valuable tool to facilitate functional studies on recalcitrant herpesvirus genes. Finally, it is postulated that the suboptimal expression of native U51 may reflect a regulatory mechanism that controls viral gene expression.
JournalJ Virol Methods. 111(2): 145-56.
SummaryThe purpose of this study was to optimize the human herpesvirus 6 U51 gene for expression in human cells. The gene was recoded based on the codon usage in human cells and inserted into the expression vector pcDNA3, then transformed into human cells of the strain HEK293A. The recoded gene was expressed at a much higher rate than the natural gene.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=677#677
PubMed ID12880930
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site