Synthetic Gene DataBase
 

Synthetic Gene 179


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID164179
GenBank AccessionNM_000364.2
GenBank GI48255876
Gene NameTNNT2TNNT2
Gene Length (bp)888888
SpeciesHomo sapiensEscherichia coli
StrainsNot specifiedBL21 (DE3)
CDSatgtctgacatagaagaggtggtggaagagtacgaggaggaggagcaggaagaagcagct
gttgaagaagaggaggactggagagaggacgaagacgagcaggaggaggcagcggaagag
gatgctgaagcagaggctgagaccgaggagaccagggcagaagaagatgaagaagaagag
gaagcaaaggaggctgaagatggcccaatggaggagtccaaaccaaagcccaggtcgttc
atgcccaacttggtgcctcccaagatccccgatggagagagagtggactttgatgacatc
caccggaagcgcatggagaaggacctgaatgagttgcaggcgctgatcgaggctcacttt
gagaacaggaagaaagaggaggaggagctcgtttctctcaaagacaggatcgagagacgt
cgggcagagcgggccgagcagcagcgcatccggaatgagcgggagaaggagcggcagaac
cgcctggctgaagagagggctcgacgagaggaggaggagaacaggaggaaggctgaggat
gaggcccggaagaagaaggctttgtccaacatgatgcattttgggggttacatccagaag
acagagcggaaaagtgggaagaggcagactgagcgggaaaagaagaagaagattctggct
gagaggaggaaggtgctggccattgaccacctgaatgaagatcagctgagggagaaggcc
aaggagctgtggcagagcatctataacttggaggcagagaagttcgacctgcaggagaag
ttcaagcagcagaaatatgagatcaatgttctccgaaacaggatcaacgataaccagaaa
gtctccaagacccgcgggaaggctaaagtcaccgggcgctggaaatag
5' End
3' End
NotesWe are currently awaiting correspondence from the author pertaining to the recoded gene sequence.
Expression VectorpET-21bpET-21b
Assay MethodsSDS-PAGESDS-PAGE
ResultsThe expression rate of the natural gene in E. coli was approximately 1% of total cell protein.The recoded gene resulted in an expression rate of 40% of total cell protein, compared to 1% for the natural gene.
Protein FunctionPlays an important role in the regulation of muscle contraction in response to alterations in calcium concentration.
Recoding PurposeTo improve expression
Synthesized ByAuthors (PCR synthesis)
Recoding MethodThe recoding method is detailed within the Discussion section of the paper.
Publication Author(s)Hu, X.; Shi, Q.; Yang, T.; Jackowski, G.
Corresponding AuthorXiuyuan Hu
Corresponding AddressSpectral Diagnostics Inc., Toronto, Ontario, Canada.
Publication Year1996
Publication TitleSpecific replacement of consecutive AGG codons results in high-level expression of human cardiac troponin T in Escherichia coli
AbstractThe adult isoform of human cardiac troponin T (TnT) contains 288 amino acids, 14 of which (4.9%) are encoded by the rarely used arginine codons (12 AGG, 2 AGA) in Escherichia coli genes. To generate sufficient quantity of TnT protein for antibody production, we cloned the corresponding cDNA and expressed it in E. coli. A low-level expression of TnT that comprised only about 1% of total cell protein was initially observed with the use of the native cDNA. The existence of two pairs of consecutive AGG codons AGG(165) AGG(166) and AGG(215) AGG(216) in the cDNA was suspected to be the main cause for this low-level expression. These two pairs of consecutive AGG codons were successively replaced with the major synonymous codon CGT by site-directed mutagenesis. As suspected, a 10-fold increase in TnT expression was obtained when one pair of the rare arginine codons was replaced and a 40-fold increase was achieved when both pairs of the rare codons were replaced. Our finding demonstrates the importance of consecutive rare codons in the suppression of high-level expression of heterologous proteins in E. coli and suggests that in order to maximize protein expression, a similar approach may be taken with other genes which contain consecutive rare codons.
JournalProtein Expr Purif. 7(3): 289-93.
SummaryThe goal of this study was to replace consecutive AGG codons in the TnT gene to optimize it for expression in E. coli. The codon replacement was performed, then the gene was cloned into pET-21b plasmid and transformed into BL21(DE3) straing E. coli. The recoded gene yielded a 40% total protein content concentration, whereas the natural gene only gave 1% total gene product.
CommentsWe are currently awaiting correspondence from the author pertaining to the recoded gene sequence.
Discussion
PubMed ID8860654
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site