Synthetic Gene DataBase
 

Synthetic Gene 180


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID165180
GenBank AccessionNC_001139.7
GenBank GI83578099
Gene NameBGL2BGL2
Gene Length (bp)942942
SpeciesSaccaromyces cerevisiaeEscherichia coli
StrainsNot specifiedBL21(DE3)
CDSatgcgtttctctactacactcgctactgcagctactgcgctatttttcacagcctcccaa
gtttcagctattggtgaactagcctttaacttgggtgtcaagaacaacgatggtacttgt
aagtccacttccgactatgaaaccgaattacaagctttgaagagctacacttccaccgtc
aaagtttacgctgcctcagattgtaacactttgcaaaacttaggtcctgctgctgaagct
gagggatttactatctttgtcggtgtttggccaacagacgacagtcattacgctgctgaa
aaggctgctttgcaaacctatttgccaaaaattaaagaatccactgttgctggtttcttg
gttggttctgaagccttataccgtaacgatttgactgcctctcaattatcagacaaaatt
aatgacgtccgtagtgtcgttgctgacatttccgattctgacggaaagtcatactctggt
aagcaagtcggtactgtcgattcctggaatgttttggttgctggttacaattctgccgtt
atcgaagcttccgattttgttatggctaacgcgttctcctactggcaaggtcaaaccatg
caaaatgcctcttactcattctttgatgatattatgcaagctctacaggttatccaatct
actaaaggttctaccgatattaccttctgggttggtgagaccggttggccaactgatggt
accaactttgaaagttcttacccatctgttgacaacgccaaacaattctggaaagaaggt
atctgttccatgagagcttggggtgttaacgttattgtttttgaagcctttgatgaagat
tggaagccaaacacctctggtacctctgatgtcgagaagcactggggtgttttcacttca
agtgacaatttgaaatactccttggactgtgacttttcatga
atgcgattcagcacgacactggcgacagcagccacagcgcttttcttcacggcaaatcaa
gtaagcgcgattggtgaactagcctttaacttgggtgtcaagaacaacgatggtacttgt
aagtccacttccgactatgaaaccgaattacaagctttgaagagctacacttccaccgtc
aaagtttacgctgcctcagattgtaacactttgcaaaacttaggtcctgctgctgaagct
gagggatttactatctttgtcggtgtttggccaacagacgacagtcattacgctgctgaa
aaggctgctttgcaaacctatttgccaaaaattaaagaatccactgttgctggtttcttg
gttggttctgaagccttataccgtaacgatttgactgcctctcaattatcagacaaaatt
aatgacgtccgtagtgtcgttgctgacatttccgattctgacggaaagtcatactctggt
aagcaagtcggtactgtcgattcctggaatgttttggttgctggttacaattctgccgtt
atcgaagcttccgattttgttatggctaacgcgttctcctactggcaaggtcaaaccatg
caaaatgcctcttactcattctttgatgatattatgcaagctctacaggttatccaatct
actaaaggttctaccgatattaccttctgggttggtgagaccggttggccaactgatggt
accaactttgaaagttcttacccatctgttgacaacgccaaacaattctggaaagaaggt
atctgttccatgagagcttggggtgttaacgttattgtttttgaagcctttgatgaagat
tggaagccaaacacctctggtacctctgatgtcgagaagcactggggtgttttcacttca
agtgacaatttgaaatactccttggactgtgacttttcatga
5' End
3' End
NotesThe gene is coded by the DNA segment complement(1057789..1058730).
Expression VectorpDPH91pDPH117
Assay MethodsSDS-PAGESDS-PAGE
ResultsThe wild type gene expressed a protein with 0.587 +- 0.07 AP activity rating, corresponding to a very low rate of expression.The recoded BGL2 gene was expressed such that the AP activity was 3.58 +- 0.98, compared to 0.587 +-0.07 for the natural gene, corresponding to a huge increase in expression.
Protein FunctionInvolved in cell wall maintenance
Recoding PurposeTo improve expression
Synthesized ByAuthors (Mutagenesis)
Recoding MethodThe recoding method was not explained in this paper
Publication Author(s)Humphreys, D. P.; Sehdev, M.; Chapman, A. P.; Ganesh, R.; Smith, B. J.; King, L. M.; Glover, D. J.; Reeks, D. G.; Stephens, P. E.
Corresponding AuthorDavid Humphreys
Corresponding AddressCelltech-Chiroscience, 216 Bath Road, Slough, Berkshire, SL1 4EN, United Kingdom. dhumphre@celltech.co.uk
Publication Year2000
Publication TitleHigh-level periplasmic expression in Escherichia coli using a eukaryotic signal peptide: importance of codon usage at the 5' end of the coding sequence
AbstractWe investigated the ability of signal peptides of eukaryotic origin (human, mouse, and yeast) to efficiently direct model proteins to the Escherichia coli periplasm. These were compared against a well-characterized prokaryotic signal peptide-OmpA. Surprisingly, eukaryotic signal peptides can work very efficiently in E. coli, but require optimization of codon usage by codon-based mutagenesis of the signal peptide coding region. Analysis of the 5' of periplasmic and cytoplasmic E. coli genes shows some codon usage differences.
JournalProtein Expr Purif. 20(2): 252-64.
SummaryThe goal of this experiment was to show that codon usage can have a huge impact on expression. Many different genes were used in the experiment, but the most prevalent one was yeast BGL2. After being recoded for optimal expression, it showed an AP activity of around 3.5, compared to the natural gene with an AP activity of around 0.5.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=654#654
PubMed ID11049749
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site