Synthetic Gene DataBase
 

Synthetic Gene 181


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID166181
GenBank AccessionNM_021213.1
GenBank GI10864026
Gene NamePC-TPPC-TP
Gene Length (bp)645657
SpeciesHomo sapiensEscherichia coli
StrainsN/ABL21 (DE3)
CDSatggagctggccgccggaagcttctcggaggagcagttctgggaggcctgcgccgagctc
cagcagcccgctctggccggggccgactggcagctcctagtggagacctcgggcatcagc
atctaccggctgctggacaagaagactggacttcatgagtataaagtctttggtgttctg
gaggactgctcaccaactctactggcagacatctatatggactcagattacagaaaacaa
tgggaccagtatgttaaagaactctatgaacaagaatgcaacggagagactgtggtctac
tgggaagtgaagtacccttttcccatgtccaacagagactatgtctaccttcggcagcgg
cgagacctggacatggaagggaggaagatccatgtgatcctggcccggagcacctccatg
cctcagcttggcgagaggtctggggtgatccgggtgaagcaatacaagcagagcctggcg
attgagagtgacggcaagaaggggagcaaagttttcatgtattacttcgataacccgggt
ggccaaattccgtcctggctcattaactgggccgccaagaatggagttcctaacttcttg
aaagacatggcaagagcctgtcagaactacctcaagaaaacctaa
atggaactggcggcgggtagcttcagcgaagaacagttctgggaagcgtgcgcggaactg
caacaaccggctctggcaggtgcggattggcagctgctggtggaaaccagcggtatcagc
atctaccgcctgctggataagaagaccggtctgtacgaatacaaagtgttcggtgtgctg
gaagattgcagcccgaccctgctggcggatatctacatggatagcgattaccgtaaacag
tgggatcagtacgtgaaagagctgtacgagcaggagtgcaacggtgaaaccgtggtgtac
tgggaagtgaaatactgggaagtgaaatacccgttcccgatgagcaaccgtgactacgtg
tacctgcgtcagcgtcgtgacctggacatggaaggtcgtaaaatccacgtgatgctggcg
cgtagcaccagcatgccgcagctgggtgaacgtagcggtgtgatccgcgtgaagcagtac
aaacagagcctggcgatcgaaagcgatggtaagaaaggcagcaaggtgttcatgtactac
ttcgacaacccgggtggtcagatcccgagctggctgatcaactgggcggcaaagaacggt
gtgccgaacttcctgaaagatatggcgcgtgcgtgccagaactacctgaagaagacc
5' End
3' End
Notes
Expression VectorN/ApET11a
Assay MethodsN/ASDS-PAGE
ResultsThe natural gene was not expressed in this study, but based on previous studies the expression is very low in E. coli.The recoded PC-TP gene accounted for approx. 8% of the total cell protein in the culture, which was a significant rise from the natural gene production rate.
Protein FunctionPromotes intermembrane transfer of phosphatidylcholines
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe recoding method was not specified in this paper.
Publication Author(s)Feng, L.; Chan, W. W.; Roderick, S. L.; Cohen, D. E.
Corresponding AuthorDavid Cohen
Corresponding AddressDepartment of Medicine, Marion Bessin Liver Research Center, Albert Einstein College of Medicine, Bronx, New York 10461, USA.
Publication Year2000
Publication TitleHigh-level expression and mutagenesis of recombinant human phosphatidylcholine transfer protein using a synthetic gene: evidence for a C-terminal membrane binding domain
AbstractPhosphatidylcholine transfer protein (PC-TP) is a 214-amino acid cytosolic protein that promotes intermembrane transfer of phosphatidylcholines, but no other phospholipid class. To probe mechanisms for membrane interactions and phosphatidylcholine binding, we expressed recombinant human PC-TP in Escherichia coli using a synthetic gene. Optimization of codon usage for bacterial protein translation increased expression of PC-TP from trace levels to >10% of the E. coli cytosolic protein mass. On the basis of secondary structure predictions of an amphipathic alpha-helix (residues 198-212) in proximity to a hydrophobic alpha-helix (residues 184-193), we explored whether the C-terminus might interact with membranes and promote binding of phosphatidylcholines. Consistent with this possibility, truncation of five residues from the C-terminus shortened the predicted amphipathic alpha-helix and decreased PC-TP activity by 50%, whereas removal of 10 residues eliminated the alpha-helix, abolished activity, and markedly decreased the level of membrane binding. Circular dichroic spectra of synthetic peptides containing one ((196-214)PC-TP) or both ((183-214)PC-TP) predicted C-terminal alpha-helices in aqueous buffer were most consistent with random coil structures. However, both peptides adopted alpha-helical configurations in the presence of trifluoroethanol or phosphatidylcholine/phosphatidylserine small unilamellar vesicles. The helical content of (196-214)PC-TP increased in proportion to vesicle phosphatidylserine content, consistent with stabilization of the alpha-helix at the membrane surface. In contrast, the helical content of (183-214)PC-TP was not influenced by vesicle composition, implying that the more hydrophobic of the alpha-helices penetrated into the membrane bilayer. These studies suggest that tandem alpha-helices located near the C-terminus of PC-TP facilitate membrane binding and extraction of phosphatidylcholines.
JournalBiochemistry. 39(50): 15399-409.
SummaryThe purpose of this study was to optimize the human PC-TP gene for expression in E. coli. The optimized gene was transformed into BL21(DE3) strain E. coli and expression increased relative to the natural gene from trace levels to greater than 10% of total cell protein.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=667#667
PubMed ID11112525
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site