Synthetic Gene DataBase
 

Synthetic Gene 182


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID168182
GenBank AccessionNC_004004.1
GenBank GI21426907
Gene NameVP1VP1
Gene Length (bp)6969216
SpeciesFoot-and-mouth disease virus - type OEscherichia coli
StrainsNot specifiedBL21(DE3)
CDSatgaatacgactgactgttttatcgctctgctatacgctctcagagagatcaaagcactg
tttctgtcacgaacacaagggaagatggaattcacactttacaacggtgaaaagaaggtc
ttctactccagacccaacaaccacgacaactgttggctgaacgccatcctccaactgttc
aggtacgttgacgagcccttcctcgaatgggtctacgactcacctgagaacctcactctc
gaggcgatcaacaaactggaagaaatcacaggtcttgagctacacgagggcggaccgccc
gcccttgtcgtctggaacatcaagcacttgctctacaccggaatcggcaccgcttcgcga
cccagcgaggtgtgcatggtggacggtacagacatgtgcttggctgacttccacgccggt
atatttctgaagggacaggaccacgccgtcttcgcctgcgtcacctctgacgggtggtac
gcgattgacgacgaggacttttacccgtggacaccaaatccggccgacgttttggttttt
gttccgtacgatcaagaaccattcaacgcagaatggaaagcaaaggttcagaagcggctc
aggggcgccgggcaatccagcccgacgaccgggtcacaaaaccaatctggcaacactggc
agcattattaacaattactacatgcagcagtaccagaactcaatggacacccaacttggc
gacaacgccattagtggagggtccaacgagggctccacggacactacctctacccacacc
aacaacacccagaacaacgactggttttcgaaactggccaacaccgcttttagcggcctc
ttcggtgctcttcttgcagacaagaagacggaagaaaccaccctcctcgaagaccgaata
ttgaccacccgtaacggccacacgacctcgacaacccagtctagcgtcggggtgacttac
gggtacgcaacggctgaagacttcgtgagtgggcctaacacctctggtcttgagaccaga
gttgttcaggccgaacggttcttcaaaacccacctgtttgactgggtcaccagtgacccg
tttgggcggtgtcacttgttggagctaccgactgaccacaaaggcgtctacggtagcctg
accgactcgtacgcatacatgaggaatggttgggacgttgaagtcaccgcagtgggtaac
caattcaacggaggctgtttgctggtggcgatggtaccggagctccgttccatcagcaag
agagagttgtaccagcttacgcttttcccccaccagttcatcaacccacggacgaatatg
acggcacacatcaccgtgccctacctcggtgtcaacaggtacgaccagtacaaggtacac
aaaccctggaccctcgtggtcatggttgcggcccccttgaccgttaacaacgagggcgct
ccgcaaatcaaggtgtatgccaacatcgcccccaccaatgttcacgtcgcgggtgagctc
ccctctaaagaggggattttccccgtggcatgcagcgatggttacggtggcttggtgacc
acggatccgaagacggcagaccccgtctacgggaaagtgttcaacccaccccgcaacctg
ttgccagggcggtttacaaacctccttgacgtggccgaggcgtgccccacattcctacac
ttcgacggtgacgttccgtacgtgaccacgaagacggattcggatagggtgctagcccag
ttcgatttgtccctcgcggcaaaacatatgtcgaacacttttctcgcgggtcttgcccag
tactacacacagtacagcggcaccattaacctgcacttcatgttcacgggacccaccgac
gcgaaggcacgctacatggttgcgtacgcccctcctggcatggaaccgccgaaaacgcct
gaggcggctgcacattgcatccacgctgagtgggatacagggctgaattcgaagttcacg
ttttcaatcccatacctttcggcagctgactacgcgtacaccgcgtccgacgtcgccgag
accacaaacgtacagggatgggtctgtttgttccagataacacacgggaaagccgacggt
gacgccctggtcgtgctagctagtgctggcaaagactttgacttgcgtctgccggtcgac
gcccgaacccaaaccacctctgcgggtgagtctgcggaccccgtgactgccaccgtcgag
aactacggtggtgagacacaagtccagaggcgccagcacacggacattgcgttcatactg
gacaggttcgtgaaagtcaagccaaaggaacaagttaatgtgttggacctgatgcagatc
cctgcccacaccttggtaggggcgctcctgcgaacggccacctactacttctctgacctg
gagctggccgtcaagcacgagggcgatctcacctgggtcccaaacggcgcccctgagaca
gcactggacaacactaccaacccaacagcttaccacaaggaacccctcacacggctggcg
ctgccttacacggctccacaccgtgtcttagcgaccgtctacaacgggagcagtaagtac
ggtgacaccagcactaacaacgtgagaggtgaccttcaagtgttagctcagaaggcagaa
agaactctgcctacctccttcaacttcggtgccatcaaggcaactcgtgttactgaacta
ctctacagaatgaagagagccgagacatactgtcccaggccccttctcgccattcaaccg
agtgacgctagacacaagcagaggattgtggcacccgcaaaacagcttctgaacttcgac
ctcctcaagttggcgggagacgttgagtccaaccccgggcccttcttcttctccgacgtc
agggcgaacttcacgaagttggtggacactgtcaaccagatgcaggaggacatgtcaacg
aaacacggacccgacttcaaccgactggtgtccgcgtttgaggaattggccgctggggtc
aaggccatcaggaccggtctcgacgaggccaagccctggtacaagctcatcaaacttcta
agccgcctgtcgtgcatggccgctgtggcagcacggtccaaggacccagtccttgtggcc
atcatgctggccgacaccggcctcgagattctggacagcaccttcgtggtaaagaagatc
tccgactcgctctccagtctcttccacgtgccggctcccgccttcagtttcggagccccg
atcctgttggccgggttggtcaaagtcgcctcgagtttcttccagtccacacccgaagac
ctcgagagagcagaaaagcagctcaaagcacgtgacatcaacgacatatttgccgttctt
aagaacggtgagtggctggtcaaactgatcctggccatccgcgactggattaaggcatgg
atcgcctcagaagagaagtttgtcaccatgacagacctggtgcctggcatccttgaaaga
caacgggatctcaatgaccccggcaaatacaaggaggccaaggaatggctggacaacgcg
cgtcaagcgtgtttgaagagcgggaacgtgcacattgccaatctgtgtaaggtggtcgct
ccggcgcccagcaagtcgagacccgaaccagtggtcgtgtgccttcgcggcaaatccggc
caagggaaaagctttctcgcgaacgttctcgcgcaggcaatttccacacacttcactggt
aggaccgactcggtctggtactgcccgcccgaccctgaccactttgacggttacaatcag
cagaccgtcgtcgtgatggacgacttgggccaaaacccagacggcaaagacttcaagtac
tttgcccaaatggtatccaccacggggttcatcccgcctatggcctcgctcgaggataag
ggtaaacccttcaacagcaaggtcataatagctacaaccaacctgtactcgggattcacc
ccaaagaccatggtgtgccccgatgcgcttaaccggaggtttcactttgacatcgacgtg
agcgccaaagacgggtacaagatcaacaacaaactggacatagtcaaagcacttgaagac
acccacgctaacccggtggcgatgttccaatacgactgcgctcttctcaacggaatggcc
gttgaaatgaagagaatgcagcaagacatgttcaagcctcaaccacccctccagaacatc
taccagctcgttcaggaggtgattgagcgggtggaactacacgaaaaggtgtcgagccac
ctgatatttaaacagatttcaatcccttcccagaagtccgtgttgtacttcctcattgag
aagggccagcacgaagcagcgatcgagttcttcgaggggatggtccacgattccatcaaa
gaggaactccgacccctcattcagcagacctcgttcgtaaaacgcgccttcaagcgcctg
aaagagaactttgaagttgtagctctgtgtttgaccctcttggcaaacatagtgattatg
ctccgccaagcgcgcaagaggtaccaatcggtggatgacccactggacggcgacgtaact
cttggcgacgcggaaaagaaccctctggagacgagtggcgctagcgctgtcggtttccga
gagagatcccccaccgagcaagggacgcgcgaagacgcgaacgctgagcccgtcgtgttc
ggtagggaacaaccgcgagctgaaggaccctacgctgggccactcgagcgtcagaaacct
cttaaagtgaaagccgagctgccacaacaggagggaccatacgccggcccaatggagaga
cagaaaccgctaaaggtgaaagcaaaagcccccgtcgtgaaggaaggaccttacgaggga
ccggtgaagaaacctgtcgctttgaaagtgaaagcaaagaacttgatagtcactgagagt
ggtgcgccaccgaccgacttgcaaaagatggtcatgggcaacactaagccagtcgagctc
atcctcgacggcaagacggtagccatttgctgtgctaccggagtgttcggcactgcctac
ctcgtgcctcgtcatctcttcgcggaaaagtacgacaagatcatgttggacggcagagcc
ttgacagacagtgactacagagtgtttgagtttgagattaaagtaaaaggacaggacatg
ctctcagacgccgctctcatggtgttgcaccgtgggaatcgcgtgcgtgacatcacgaaa
cactttcgtgacgtagcgagaatgaagaagggaacccccgtcgtcggtgtgatcaacaat
gctgacgtcgggagactcatattctctggtgaagcccttacttacaaggacatcgtcgtg
tgtatggatggagacaccatgcctgggctctttgcctacagggcatccaccaaggcaggc
tactgtggaggagccgtcctggcaaaggacggggccgaaacgttcatcgttggcacccac
tccgcaggtggaaacggcataggatactgttcgtgtgtttcccgatcaatgctcctgaag
atgaaggcacacatcgaccctgaaccacaccacgaggggttgatcgtcgacaccagagat
gtggaggagcgtgtccacgtgatgcgcaaaaccaagctcgcgcccaccgtggcgcacggt
gtgttcaaccctgagttcgggcctgccgctctgtccaacaaggacccgcgcctgaacgaa
ggggttgtccttgacgatgtcattttctccaaacacaaaggagatacaaggatgtctgaa
gaggacaaagcgctgtttcggcgctgtgctgctgactacgcgtcgcgtctacacagtgtg
ttggggacagcaaacgccccactgagtgtgtatgaagccatcaaaggcgtcgacggactt
gacgccatggagccggacacggcgcccggtctcccctgggctctccaagggaaacgccgc
ggcgccctgatcgacttcgaaaacggcaccgtcgggcctgaggttgaggcagcactcaag
ctcatggaaagccgcgagtacaaattcgtctgccaaaccttcctgaaggacgaaattcgg
ccgctagaaaaggtacgcgctggcaagacacgcattgtcgacgtgttgcctgttgaacac
attctctacaccagaatgatgattggcagattctgtgctcagatgcattcaaacaacgga
ccgcaaattggatcagcggtcggttgtaaccctgacgttgattggcaaagatttggcaca
catttcgcccagtacaaaaacgtgtgggatgtggactactcagcctttgatgcaaaccac
tgcagcgatgcgatgaacatcatgttcgaggaagtgttccgcacggagttcggattccac
ccgaacgccgagtggattctgaagactctagtgaacacggagcacgcttacgagaacaag
cgcattgttgttgaaggtggaatgccgtccggttgttccgcaacaagcatcatcaacaca
attttgaacaacatctacgtgctttacgccctgcgtaggcactatgagggagtcgagctg
gacacttacaccatgatctcttatggagacgacatcgtggtggcaagtgactacgacctg
gactttgaggctctcaagccccacttcaagtcccttggtcagactatcactccggccgac
aaaagcgacaaaggttttgttcttggtcactccataaccgacgtcactttcctcaaaaga
cacttccacatggactacggaactgggttttacaaacctgtgatggcctcgaagaccctc
gaggccatcctctcctttgcacgccgtgggaccatacaggagaagttgatctccgtggca
ggactcgccgtccactccggacctgatgaataccggcgcctctttgagcccttccaaggc
ctcttcgagattccaagctacagatcactttacctgcgatgggtgaacgccgtgtgcggt
gacgcataa
atggaaacccaggttcagcgtcgtcagcacaccgacatcgctttcatcctggaccgtttc
gttggtggttctggtggtaagtacggtgacacctctaccaacaacgttcgtggtgacctg
caggttctggctcagaaggctgaacgtaccctgccgggtggttctggtggtcgtcacaag
cagcgtatcgttgctccggctaagcagctgctgtaa
5' End
3' End
Notes
Expression VectorpGEX6P-mVP1pGEX6P-mVP1
Assay MethodsWestern BlotWestern Blot
ResultsThe natural gene was not expressed in this experiment.The recoded gene yielded approx. 0.18 g/L of protein, a significant improvement over the natural gene.
Protein FunctionCapsid protein complex
Recoding PurposeTo improve solubility
Synthesized ByAuthors
Recoding MethodThe recoding method was not explained in this paper.
Publication Author(s)Song, H.; Fang, W.; Wang, Z.; Zheng, D.; Du, J.; Li, H.; Li, Y.; Qiu, B.
Corresponding AuthorHouhui Song
Corresponding AddressCentre for Molecular Microbiology, Institute of Microbiology, Chinese Academy of Sciences, 13 Zhongguancun Beiyitiao, Beijing 100080, PR China. songhouhui@yahoo.com.cn
Publication Year2004
Publication TitleDetection of foot-and-mouth virus antibodies using a purified protein from the high-level expression of codon-optimized, foot-and-mouth disease virus complex epitopes in Escherichia coli
AbstractA codon optimized DNA sequence coding for foot-and-mouth disease virus (FMDV) capsid protein complex epitopes of VP1 amino acid residues 21-40, 135-160, and 200-213 was genetically fused to the C-terminal end of a glutathione-S-transferase (GST) gene in pGEX-6P-1 vector with the synonymous codons preferred by Escherichia coli . The gene was synthesized using PCR and subsequently expressed in E. coli producing an intracellular, soluble fusion protein that retained antigenicity associated with FMDV antibodies by western blot analysis. The chimera was purified from bacterial lysates by affinity chromatography and could be used in ELISA tests for antibodies against FMDV.
JournalBiotechnol Lett. 26(16): 1277-81.
SummaryThe goal of this experiment was to optimize the foot-and-mouth disease virus capsid protein complex VP1 for expression in E. coli. The recoded gene was transformed into BL21(DE3) strain E. coli, and the expression rate was approximately 0.18g/L, a significant improvement over the natural gene.
CommentsThe optimized CDS is much shorter than the CDS downloaded from Genbank, likely because the optimized gene only codes for the mature protein.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=678#678
PubMed ID15483387
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site