Synthetic Gene DataBase
 

Synthetic Gene 183


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID169183
GenBank AccessionNM_000315.2
GenBank GI39995098
Gene NamePTHPTH
Gene Length (bp)348348
SpeciesHomo sapiensEscherichia coli
StrainsN/ACAG629
CDSatgatacctgcaaaagacatggctaaagttatgattgtcatgttggcaatttgttttctt
acaaaatcggatgggaaatctgttaagaagagatctgtgagtgaaatacagcttatgcat
aacctgggaaaacatctgaactcgatggagagagtagaatggctgcgtaagaagctgcag
gatgtgcacaattttgttgcccttggagctcctctagctcccagagatgctggttcccag
aggccccgaaaaaaggaagacaatgtcttggttgagagccatgaaaaaagtcttggagag
gcagacaaagctgatgtgaatgtattaactaaagctaaatcccagtga
5' End
3' End
NotesWe are currently awaiting correspondence from the author pertaining to the recoded gene sequence.
Expression VectorN/ApJLA505
Assay MethodsN/AWestern Blot
ResultsThe natural gene was not expressed in this study, however prior studies have shown that the expression in E. coli is very low.The recoded sequence yielded a "remarkable increased expression" of hPTH compared with the natural gene.
Protein FunctionRegulates calcium phosphorus metabolism.
Recoding PurposeTo improve expression
Synthesized ByAuthors (PCR synthesis)
Recoding MethodThe recoding method was not explained in this paper.
Publication Author(s)Morelle, G.; Frank, R.; Meyerhans, A.
Corresponding AuthorAndreas Meyerhans
Corresponding AddressDivision of Enzymtechnology, GBF-Gesellschaft fur Biotechnologische Forschung, Braunschweig, F.R.G.
Publication Year1991
Publication TitleRestructuring the translation initiation region of the human parathyroid hormone gene for improved expression in Escherichia coli
AbstractOverexpression of native human parathyroid hormone in Escherichia coli was achieved by a modification of the 5' end of the genomic gene sequence, thereby adapting this part of the translation initiation region to the bacterial host. Some simple rules abstracted from optimization studies of translation initiation of a beta-interferon gene were applied. These included (a) extending complementarity of the mRNA to the anticodon loop of tRNAfMet by use of a codon with a purine nucleotide directly following the ATG, (b) avoidance of stable secondary structure in the mRNA by use of synonymous A/U-rich codons, (c) elimination of a potential second Shine-Dalgarno sequence. The appropriate silent changes led to a 20-fold increase in parathyroid hormone production resulting in 4.3% of total soluble protein. This result proves the validity of our simple approach for optimization of foreign gene expression in E. coli.
JournalBiochim Biophys Acta. 1089(3): 320-4.
SummaryThe goal of this experiment was to recode the translation initiation region on the hPTH gene to optimize expression in E. coli. The recoded gene was cloned into pJLA505 expression vector and then transformed into CAG629 strain E. coli. This resulted in a "remarkable increased expression" of PTH.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=670#670
PubMed ID1859835
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site