Synthetic Gene DataBase
 

Synthetic Gene 184


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID170184
GenBank AccessionD86226.1
GenBank GI1402635
Gene NameNRNR-opt
Gene Length (bp)375375
SpeciesSpinacia oleraciaEscherichia coli
StrainsNot specifiedBL21(DE3)
CDSatgcaccatcaccatcaccacatggcatccaccccattcatgaacaacaactcaaagatg
tactcaatgtcagaggtgaagaaacacaacactgctgactcagcttggattgtagtccat
ggaaatgtctacaacgcgacccggttcctaaaggatcacccgggtgggtcagacagtatc
ctcatcaatgcaggaaccgactgcaccgaagagttcgatgcaattcactcagacaaggcc
aagaggcttctagaagatttcaggataggtgagttgatctcaacgggctacacctctgac
tcgtcctcgcccggtaactcagtccatggcgggtcggtttactccgggttagccgggtta
gccccaattacagaa
atgcaccatcaccatcaccacatggcgagcaccccgttcatgaacaccaccagcaagatg
tacagcatgagcgaagtgaagaaacataacaccgcggatagcgcgtggatcgtggttcat
ggcaacgtgtataacgcgacccgttttctgaaagaccatccgggcggcagcgatagcatt
ctgatcaacgcgggcaccgattgcaccgaagaatttgatgcgattcacagcgacaaagcg
aaacgtctgctggaagacttccgtattggcgaactgatcagcaccgggtataccagcgat
agctcttccccgggtaatagcgttcatggcggtagcgtttatagcggtctggcgggcctg
gcgccgattaccgaa
5' End
3' End
Notes
Expression VectorpET23bpET23b
Assay MethodsSDS-PAGESDS-PAGE
ResultsThe natural gene was expressed poorly in E. coli.Significant quantities of a C-terminal shortened form of the heme domain were produced following truncation of the 3' end of the synthetic gene.
Protein FunctionCatalyzes the rate-limiting step in the pathway of inorganic nitrogen assimilation.
Recoding PurposeTo allow detailed analysis of interation with cytochrome c
Synthesized ByAuthors
Recoding MethodThe recoding method was not explained in this paper.
Publication Author(s)Barber MJ, Desai SK, Marohnic CC, Hernandez HH, Pollock VV.
Corresponding AuthorMicheal Barber
Corresponding AddressDepartment of Biochemistry and Molecular Biology, College of Medicine, University of South Florida, Tampa, FL 33612, USA.
Publication Year2002
Publication TitleSynthesis and bacterial expression of a gene encoding the heme domain of assimilatory nitrate reductase.
AbstractAssimilatory NADH:nitrate reductase (EC 1.6.6.1), a complex Mo-pterin-, cytochrome b(557)-, and FAD-containing protein, catalyzes the regulated and rate-limiting step in the utilization of inorganic nitrogen by higher plants. A codon-optimized gene has been synthesized for expression of the central cytochrome b(557)-containing fragment, corresponding to residues A542-E658, of spinach assimilatory nitrate reductase. While expression of the full-length synthetic gene in Escherichia coli did not result in significant heme domain production, expression of a Y647* truncated form resulted in substantial heme domain production as evidenced by the generation of "pink" cells. The histidine-tagged heme domain was purified to homogeneity using a combination of NTA-agarose and size-exclusion FPLC, resulting in a single protein band following SDS-PAGE analysis with a molecular mass of approximately 13 kDa. MALDI-TOF mass spectrometry yielded an m/z ratio of 12,435 and confirmed the presence of the heme prosthetic group (m/z=622) while cofactor analysis indicated a 1:1 heme to protein stoichiometry. The oxidized heme domain exhibited spectroscopic properties typical of a b-type cytochrome with a visible Soret maximum at 413 nm together with epr g-values of 2.98, 2.26, and 1.49, consistent with low-spin bis-histidyl coordination. Oxidation-reduction titrations of the heme domain indicated a standard midpoint potential (E(o)') of -118 mV. The isolated heme domain formed a 1:1 complex with cytochrome c with a K(A) of 7 microM (micro=0.007) and reconstituted NADH:cytochrome c reductase activity in the presence of a recombinant form of the spinach nitrate reductase flavin domain, yielding a k(cat) of 1.4 s(-1) and a K(m app) for cytochrome c of 9 microM. These results indicate the efficient expression of a recombinant form of the heme domain of spinach nitrate reductase that retained the spectroscopic and thermodynamic properties characteristic of the corresponding domain in the native spinach enzyme.
JournalArch Biochem Biophys.. 402(1): 38-50.
SummaryThe goal of this experiment was to optimize the expression of the central cytochrome b557 containing fragment of spinach nitrate reductase. The optimized gene was inserted into pET23b expression vector then transformed into BL21(DE3) strain E. coli. The optimized gene expressed significant quantities of a shortened form of the heme domain, whereas the natural gene was not expressed significantly.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=666#666
PubMed ID12051681
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site