Synthetic Gene DataBase
 

Synthetic Gene 185


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID171185
GenBank AccessionX69131
GenBank GI21328
Gene NameSAPsynthetic SAP
Gene Length (bp)762765
SpeciesSaponaria officinalisMus musculus
StrainsNIH 3T3
CDSgtcacatcaatcacattagatctagtaaatccgaccgcgggtcaatactcatcttttgtg
gataaaatccgaaacaacgtaaaggatccaaacctgaaatacggtggtaccgacatagcc
gtgataggcccaccttctaaagaaaaattccttagaattaatttccaaagttcccgagga
acggtctcacttggcctaaaacgcgataacttgtatgtggtcgcgtatcttgcaatggat
aacacgaatgttaatcgggcatattacttcagatcagaaattacttccgccgagttaacc
gcccttttcccagaggccacaactgcaaatcagaaagctttagaatacacagaagattat
cagtcgatcgaaaagaatgcccagataacacagggagataaatcaagaaaagaactcggg
ttggggatcgacttacttttgacgtccatggaagcagtgaacaagaaggcacgtgtggtt
aaaaacgaagctaggtttctgcttatcgctattcaaatgacagctgaggtagcacgattt
cggtacattcaaaacttggtaactaagaacttccccaacaagttcgactcggataacaag
gtgattcaatttgaagtcagctggcgtaagatttctacggcaatatacggagatgccaaa
aacggcgtgtttaataaagattatgatttcgggtttggaaaagtgaggcaggtgaaggac
ttgcaaatgggactccttatgtatttgggcaaaccaaagtag
atggtgacctccatcaccctggacctggtgaaccccaccgccggccagtactcctccttc
gtggacaagatccgcaacaacgtgaaggaccccaacctgaagtacggcggcaccgacatc
gccgtgatcggccccccctccaaggagaagttcctgcgcatcaacttccagtcctcccgc
ggcaccgtgtccctgggcctgaagcgcgacaacctgtacgtggtggcctacctggccatg
gacaacaccaacgtgaaccgcgcctactacttcaagtccgagatcacctccgccgagctg
accgccctgttccctgaggccaccaccgccaaccagaaggccctggagtacaccgaggac
tacgactccatcgagaagaacgcccagatcacccagggcgacaagtcccgcaaggagctc
gggctgggcatcgacctgctgctgaccttcatggaggccgtgaacaagaaggcccgcgtg
gtgaagaacgaggcccgcttcctgctgatcgccatccagatgaccgccgaggtggcccgc
ttccgctacatccagaacctggtgaccaagaacttccccaacaagttcgactccgacaac
aaggtgatccagttcgaggtcagctggcgcaagatctccaccgccatctacggcgacgcc
aagaacggcgtgttcaacaaggactacgacttcggcttcggcaaggtgcgccaggtgaag
gacctccagatgggcctgctgatgtacctgggcaagcccaagtag
5' End
3' End
NotesNo tests with the natural gene. Earlier studies were unsuccessful in creating functional protein.Quantitative tests for the protein were not able to be performed, instead the number of cells remaining after transformation with the SAP constructs was done, as well as tests to confirm the actual presence of the protein.
Expression VectorpSV-beta-gal
Assay MethodsWestern Blot, cytotoxicity assay
ResultsSignificant amount (41-66% decrease in cell number, indicating the presence of the protein and proper function)
Protein FunctionRibosome inactivation
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodNatural gene was codon optimized based on the codon usage patterns of highly expressed mammalian
genes. A Kozak consensus sequence was added to the gene.
Publication Author(s)Hoganson, D. K.; Chandler, L. A.; Fleurbaaij, G. A.; Ying, W.; Black, M. E.; Doukas, J.; Pierce, G. F.; Baird, A.; Sosnowski, B. A.
Corresponding AuthorBarbara A. Sosnowski
Corresponding AddressSelective Genetics, Inc., San Diego, CA 92121, USA.
Publication Year1998
Publication TitleTargeted delivery of DNA encoding cytotoxic proteins through high-affinity fibroblast growth factor receptors
AbstractNonviral DNA delivery strategies for gene therapy have generally been limited by a lack of specificity and efficacy. However, ligand-mediated endocytosis can specifically deliver DNA in vitro to cells bearing the appropriate cognate receptors. Similarly, in order to circumvent problems related to efficacy, DNA must encode proteins with high intrinsic activities. We show here that the ligand basic fibroblast growth factor (FGF2) can target FGF receptor-bearing cells with DNA encoding therapeutic proteins. Delivery of genes encoding saporin, a highly potent ribosomal inactivating protein, or the conditionally cytotoxic herpes simplex virus thymidine kinase, a protein that can kill cells by activating the prodrug ganciclovir, is demonstrated. The saporin gene was codon optimized for mammalian expression and demonstrated to express functional protein in a cell-free assay. FGF2-mediated delivery of saporin DNA or thymidine kinase DNA followed by ganciclovir treatment resulted in a 60 and 75% decrease in cell number, respectively. Specificity of gene delivery was demonstrated in competition assays with free FGF2 or with recombinant soluble FGF receptor. Alternatively, when histone H1, a ligand that binds to cell surface heparan sulfate proteoglycans (""low-affinity"" FGF receptors), was used to deliver DNA encoding thymidine kinase, no ganciclovir sensitivity was observed. These findings establish the feasibility of using ligands such as FGF2 to specifically deliver genes encoding molecular chemotherapeutic agents to cells.
JournalHum Gene Ther. 9(17): 2565-75.
SummaryMouse (Mus musculus) fibroblast cells were transformed with a recoded version of the SAP gene, synthetic SAP, in order to increase the expression of saporin, an enzyme. SAP was codon optimized based on the codon usage patterns of mammalian genes. As expected, synthetic SAP was able to produce a significant yield of protein (earlier studies had no production with wild type SAP). Recoding was successful since it was able to increase the expression of saporin and remain functional.
CommentsThe CDS for the natural gene was taken from the NCBI database using references in the article and BLAST queries.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=563
PubMed ID9853523
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site