Synthetic Gene DataBase
 

Synthetic Gene 186


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID172186
GenBank AccessionNM_000501.1
GenBank GI5881412
Gene NameTELSHEL
Gene Length (bp)22742205
SpeciesHomo sapiensEscherichia coli
StrainsN/ABL21(DE3)
CDSatggcgggtctgacggcggcggccccgcggcccggagtcctcctgctcctgctgtccatc
ctccacccctctcggcctggaggggtccctggggccattcctggtggagttcctggagga
gtcttttatccaggggctggtctcggagcccttggaggaggagcgctggggcctggaggc
aaacctcttaagccagttcccggagggcttgcgggtgctggccttggggcagggctcggc
gccttccccgcagttacctttccgggggctctggtgcctggtggagtggctgacgctgct
gcagcctataaagctgctaaggctggcgctgggcttggtggtgtcccaggagttggtggc
ttaggagtgtctgcaggtgcggtggttcctcagcctggagccggagtgaagcctgggaaa
gtgccgggtgtggggctgccaggtgtatacccaggtggcgtgctcccaggagctcggttc
cccggtgtgggggtgctccctggagttcccactggagcaggagttaagcccaaggctcca
ggtgtaggtggagcttttgctggaatcccaggagttggaccctttgggggaccgcaacct
ggagtcccactggggtatcccatcaaggcccccaagctgcctggtggctatggactgccc
tacaccacagggaaactgccctatggctatgggcccggaggagtggctggtgcagcgggc
aaggctggttacccaacagggacaggggttggcccccaggcagcagcagcagcggcagct
aaagcagcagcaaagttcggtgctggagcagccggagtcctccctggtgttggaggggct
ggtgttcctggcgtgcctggggcaattcctggaattggaggcatcgcaggcgttgggact
ccagctgcagctgcagctgcagcagcagccgctaaggcagccaagtatggagctgctgca
ggcttagtgcctggtgggccaggctttggcccgggagtagttggtgtcccaggagctggc
gttccaggtgttggtgtcccaggagctgggattccagttgtcccaggtgctgggatccca
ggtgctgcggttccaggggttgtgtcaccagaagcagctgctaaggcagctgcaaaggca
gccaaatacggggccaggcccggagtcggagttggaggcattcctacttacggggttgga
gctgggggctttcccggctttggtgtcggagtcggaggtatccctggagtcgcaggtgtc
cctagtgtcggaggtgttcccggagtcggaggtgtcccgggagttggcatttcccccgaa
gctcaggcagcagctgccgccaaggctgccaagtacggagtggggaccccagcagctgca
gctgctaaagcagccgccaaagccgcccagtttgggttagttcctggtgtcggcgtggct
cctggagttggcgtggctcctggtgtcggtgtggctcctggagttggcttggctcctgga
gttggcgtggctcctggagttggtgtggctcctggcgttggcgtggctcccggcattggc
cctggtggagttgcagctgcagcaaaatccgctgccaaggtggctgccaaagcccagctc
cgagctgcagctgggcttggtgctggcatccctggacttggagttggtgtcggcgtccct
ggacttggagttggtgctggtgttcctggacttggagttggtgctggtgttcctggcttc
ggggcaggtgcagatgagggagttaggcggagcctgtcccctgagctcagggaaggagat
ccctcctcctctcagcacctccccagcaccccctcatcacccagggtacctggagccctg
gctgccgctaaagcagccaaatatggagcagcagtgcctggggtccttggagggctcggg
gctctcggtggagtaggcatcccaggcggtgtggtgggagccggacccgccgccgccgct
gccgcagccaaagctgctgccaaagccgcccagtttggcctagtgggagccgctgggctc
ggaggactcggagtcggagggcttggagttccaggtgttgggggccttggaggtatacct
ccagctgcagccgctaaagcagctaaatacggtgctgctggccttggaggtgtcctaggg
ggtgccgggcagttcccacttggaggagtggcagcaagacctggcttcggattgtctccc
attttcccaggtggggcctgcctggggaaagcttgtggccggaagagaaaatga
atgggtggcgttccgggtgctatcccgggtggcgttccgggtggtgtattctacccaggc
gcgggtctgggtgcactgggcggtggtgcgctgggcccgggtggtaaaccgctgaaaccg
gttccaggcggtctggcaggtgctggtctgggtgcaggtctgggcgcgttcccggcggtt
accttcccgggtgctctggttccgggtggcgttgcagacgcagctgctgcgtacaaagcg
gcaaaggcaggtgcgggtctgggcggggtaccaggtgttggcggtctgggtgtatctgct
ggcgcagttgttccgcagccgggtgcaggtgtaaaaccgggcaaagttccaggtgttggt
ctgccgggcgtatacccgggtggtgttctgccgggcgcgcgtttcccaggtgttggtgta
ctgccgggcgttccgaccggtgcaggtgttaaaccgaaggcaccaggtgtaggcggcgcg
ttcgcgggtatcccgggtgttggcccgttcggtggtccgcagccaggcgttccgctgggt
tacccgatcaaagcgccgaagcttccaggtggctacggtctgccgtacaccaccggtaaa
ctgccgtacggctacggtccgggtggcgtagcaggtgctgcgggtaaagcaggctaccca
accggtactggtgttggtccgcaggctgctgcggcagctgcggcgaaggcagcagcaaaa
ttcggcgcgggtgcagcgggtgttctgccgggcgtaggtggtgctggcgttccgggtgtt
ccaggtgcgatcccgggcatcggtggtatcgcaggcgtaggtactccggcggccgctgcg
gctgcggcagctgcggcgaaagcagctaaatacggtgcggcagcaggcctggttccgggt
ggtccaggcttcggtccgggtgttgtaggcgttccgggtgctggtgttccgggcgtaggt
gttccaggtgcgggcatcccggttgtaccgggtgcaggtatcccgggcgctgcggttcca
ggtgttgtatccccggaagcggcagctaaggctgctgcgaaagctgcgaaatacggagct
cgtccgggcgttggtgttggtggcatcccgacctacggtgtaggtgcaggcggtttccca
ggtttcggcgttggtgttggtggcatcccgggtgtagctggtgttccgtctgttggtggc
gtaccgggtgttggtggcgttccaggtgtaggtatctccccggaagcgcaggcagctgcg
gcagctaaagcagcgaagtacggcgttggtactccggcggcagcagctgctaaagcagcg
gctaaagcagcgcagttcggactagttccgggcgtaggtgttgcgccaggtgttggcgta
gcaccgggtgttggtgttgctccgggcgtaggtctggcaccgggtgttggcgttgcacca
ggtgtaggtgttgcgccgggcgttggtgtagcaccgggtatcggtccgggtggcgttgcg
gctgctgcgaaatctgctgcgaaggttgctgcgaaagcgcagctgcgtgcagcagctggt
ctgggtgcgggcatcccaggtctgggtgtaggtgttggtgttccgggcctgggtgtaggt
gcaggggtaccgggcctgggtgttggtgcaggcgttccgggtttcggtgctggcgcggac
gaaggtgtacgtcgttccctgtctccagaactgcgtgaaggtgacccgtcctcttcccag
cacctgccgtctaccccgtcctctccacgtgttccgggcgcgctggctgctgcgaaagcg
gcgaaatacggtgcagcggttccgggtgtactgggcggtctgggtgctctgggcggtgtt
ggtatcccgggcggtgttgtaggtgcaggcccagctgcagctgctgctgcggcaaaggca
gcggcgaaagcagctcagttcggtctggttggtgcagcaggtctgggcggtctgggtgtt
ggcggtctgggtgtaccgggcgttggtggtctgggtggcatcccgccggcggcggcagct
aaagcggctaaatacggtgcagcaggtctgggtggcgttctgggtggtgctggtcagttc
ccactgggcggtgtagcggcacgtccgggtttcggtctgtccccgatcttcccaggcggt
gcatgcctgggtaaagcttgcggccgtaaacgtaaataatgatag
5' End
3' End
Notes
Expression VectorpGEX-2TpGEX-2T
Assay MethodsN/ASDS-PAGE
ResultsThe natural gene was not expressed in this study.Expression of protein with the recoded gene was approx. 3mg/100mL, much higher than the natrual gene.
Protein FunctionProvides elastic properties to tissues
Recoding PurposeTo improve expression and solubility
Synthesized ByAuthors
Recoding MethodThe recoding method was not specified in this paper, but the codons used when optimizing the gene
are shown in Table 1.
Publication Author(s)Martin, S. L.; Vrhovski, B.; Weiss, A. S.
Corresponding AuthorAnthony Weiss
Corresponding AddressDepartment of Biochemistry, University of Sydney, NSW, Australia.
Publication Year1995
Publication TitleTotal synthesis and expression in Escherichia coli of a gene encoding human tropoelastin
AbstractTo elucidate the structural features and interactions of tropoelastin (TEL) molecules which assist in giving the elastic fibre its physical properties, a 2210-bp synthetic human TEL-encoding gene (SHEL) was constructed for expression in Escherichia coli. To this end, a model of codon adjustment was tested which better suits the polypeptide biosynthetic needs of E. coli than the human sequence, where over one-third of this natural sequence contains expression-limiting rare codons and 4 amino acids alone account for 75% of the resulting polypeptide. This large synthetic TEL gene was expressed at a high level as the recombinant counterpart of human TEL and as a C-terminal fusion with glutathione S-transferase. This demonstrates that a synthetic approach based upon matching codon usage to that of the host organism can support significant expression of recombinant sequences. The synthetic gene incorporates the facility for simple cassette replacement in future insertion, deletion and mutagenesis experiments, including the introduction and removal of exon homologues. The resulting soluble polypeptide is easily purified and displays properties expected for this protein.
JournalGene. 154(2): 159-66.
SummaryThe goal of this experiment was to optimize the human tropoelastin gene for expression in E. coli. The recoded gene was cloned into pGEX-2T expression vector and transformed into E. coli cells. The expression rate was approx. 3mg/100ml protein, significantly higher than the expression of the natural gene.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=673#673
PubMed ID7890158
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site