Synthetic Gene DataBase
 

Synthetic Gene 187


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID173187
GenBank AccessionAF031196
GenBank GI16876478
Gene NamesmGCPRoptimized smGCPR
Gene Length (bp)16830
SpeciesSchistosoma mansoniHomo sapiens
StrainsPuerto RicanHEK293 cells
CDSatgcaatatataaacaaaacgtcgctaaattccagtgttattccagattccctaatcaaa
tcatggatcctctcgaaccctataataaaatggaccatatcattatttttaattatagcc
actgggactacattcttcggaaatctgttaataattcttgcttttataacaaatagtcgc
ttacggcgtataacggatcaatacattgtttcgcttgctgtggctgatctacttgtatcg
gtcttagtgctgcctctggctatcgttcgtcagaatttaggttattggccattcgaatct
gatcgattgtgtcagttttggttatccgctaatattgtattatgtatggcatctatacta
aatttatgttgtatatctctggatagatatattgcaatcagccgtccaatgaaatatttc
acaaagcgtactcgttttacagcctctacaatgatagctgttgcttggatattaccactt
ataactatgcttctcccctttgttggtgggaatcagcacactttgggacttggatcatgt
catatcacatataataaagcatataggatttattcttcaattgttggatttttcggacca
tttctgctaattgcttatatatatttacgagtgttttggataataaagcatcgtttaaag
gtcttacaaattacaaacattaaactttcctcactcaaaaaacctaaatcacatattaaa
gcgacacgtaagccagctccgataataataaatttgcaacaagtttgggaaaatattaaa
ggaaagattggcaaagtaaatattttacgaaatcagtcatctaaatcaaagaatacttgc
ccatatagtggccattttttccattctgatgaaaatggatgtaatcaaatttatgcgagt
tgtttactcaaccacaaacatccctttgattcttttagaagtgatgatattcttaatgaa
gaaatcgataggaattatagacaaaaaatattagatattaagatgaacaaaacagataga
gaattttctttgacatctcaagatcacgttgaattagatttccccgaaccaacagatcaa
aaactaaaagtaatacaaatatttaatatttcaacgtcagagaaagaattacaaaaggcg
aattgggaaccaacaccaaatgtaacattgaaaagtgaaacaaaacaacatcaacacgat
tacttacatagaagtaatgaagaacaaaagaataaactaggagacaaacaattaattaat
tcttcgaaattaccatcattaacatcatttagtatagatcatataaagaagcttcgacga
ttgaaatctttaccaaattttaaaacagaatacaataaaacagaacaatcacaaaagaat
ctaatttattatcgacatgatcatttcatatttcatagggaacaaaaaactgcattaatt
ttagctgcagttgttggatgttttacaatatgttggtttccattttttatatgtattatt
ggtgaagctatatgtgattgtcaatattcaaatactataattacatttgtttcatggtta
ggttattttaatagtatttgtaatccatttatatatgcattttttaaaaaagaatatgcc
aaatcatttaaatatattattcaagttaacaaatggaatattaaaagctataaccataaa
taa
5' End
3' End
NotesThere were no quantitative results.
Expression VectorpCEP4pCEP4
Assay MethodsWestern Blot, immunofluorescence assayWestern Blot, immunofluorescence assay
ResultsBarely detectable amountsSignificant amount (A much thicker band was shown for the recoded gene, whereas the natural gene had a very thin and faint one)
Protein Functionhistamine receptive G-protein coupled receptor
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe first half (268-1122bp) of the natural gene was codon optimized based on the preferred codons of
Homos sapiens. A Kozak sequence and FLAG epitope was placed before the start codon as well.
Publication Author(s)Hamdan, F. F.; Mousa, A.; Ribeiro, P.
Corresponding AuthorPaula Ribeiro
Corresponding AddressInstitute of Parasitology, McGill University, 21, 111 Lakeshore Road, Ste. Anne de Bellevue, Quebec H9X 3V9, Canada.
Publication Year2002
Publication TitleCodon optimization improves heterologous expression of a Schistosoma mansoni cDNA in HEK293 cells
AbstractDifferences in codon usage can seriously hamper the expression of cloned cDNAs in heterologous systems. In this study, we show that the expression of a cloned Schistosoma mansoni cDNA in cultured HEK293 cells was dramatically increased by rewriting a portion of the cDNA according to human preferred codon usage, suggesting that codon optimization is a valuable strategy for improving the heterologous expression of helminth sequences. We further describe a simple modification of a recursive PCR-based method, which allows the rewriting of long stretches of DNA sequence in a single PCR reaction. This method can be used to optimize the codon usage of virtually any DNA from helminths and other parasites.
JournalParasitol Res. 88(6): 583-6.
SummaryHuman (Homo sapien) HEK293 cells where transformed with a recoded version of the smGCPR, optimized smGCPR, in order to increase the expression of the smGCPR protein. The natural gene was partially codon optimized (the first half) in order to attain the recoded optimized smGCPR. The codon optimized version of the gene had a significant amount of protein detected in Western Blot tests, whereas the natural gene had barely detectable levels, leading to the conclusion that the codon optimization was successful.
CommentsNo accession number or CDS was provided for the recoded gene. Correspodning author was emailed on 1/27/2006
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=546
PubMed ID12107483
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site