Synthetic Gene DataBase
 

Synthetic Gene 188


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID174188
GenBank AccessionM29540
GenBank GI180222
Gene NameCEACEAopt
Gene Length (bp)21092109
SpeciesHomo sapiensMus musculus
StrainsC57B1/6
CDSatggagtctccctcggcccctccccacagatggtgcatcccctggcagaggctcctgctc
acagcctcacttctaaccttctggaacccgcccaccactgccaagctcactattgaatcc
acgccgttcaatgtcgcagaggggaaggaggtgcttctacttgtccacaatctgccccag
catctttttggctacagctggtacaaaggtgaaagagtggatggcaaccgtcaaattata
ggatatgtaataggaactcaacaagctaccccagggcccgcatacagtggtcgagagata
atataccccaatgcatccctgctgatccagaacatcatccagaatgacacaggattctac
accctacacgtcataaagtcagatcttgtgaatgaagaagcaactggccagttccgggta
tacccggagctgcccaagccctccatctccagcaacaactccaaacccgtggaggacaag
gatgctgtggccttcacctgtgaacctgagactcaggacgcaacctacctgtggtgggta
aacaatcagagcctcccggtcagtcccaggctgcagctgtccaatggcaacaggaccctc
actctattcaatgtcacaagaaatgacacagcaagctacaaatgtgaaacccagaaccca
gtgagtgccaggcgcagtgattcagtcatcctgaatgtcctctatggcccggatgccccc
accatttcccctctaaacacatcttacagatcaggggaaaatctgaacctctcctgccac
gcagcctctaacccacctgcacagtactcttggtttgtcaatgggactttccagcaatcc
acccaagagctctttatccccaacatcactgtgaataatagtggatcctatacgtgccaa
gcccataactcagacactggcctcaataggaccacagtcacgacgatcacagtctatgca
gagccacccaaacccttcatcaccagcaacaactccaaccccgtggaggatgaggatgct
gtagccttaacctgtgaacctgagattcagaacacaacctacctgtggtgggtaaataat
cagagcctcccggtcagtcccaggctgcagctgtccaatgacaacaggaccctcactcta
ctcagtgtcacaaggaatgatgtaggaccctatgagtgtggaatccagaacgaattaagt
gttgaccacagcgacccagtcatcctgaatgtcctctatggcccagacgaccccaccatt
tccccctcatacacctattaccgtccaggggtgaacctcagcctctcctgccatgcagcc
tctaacccacctgcacagtattcttggctgattgatgggaacatccagcaacacacacaa
gagctctttatctccaacatcactgagaagaacagcggactctatacctgccaggccaat
aactcagccagtggccacagcaggactacagtcaagacaatcacagtctctgcggagctg
cccaagccctccatctccagcaacaactccaaacccgtggaggacaaggatgctgtggcc
ttcacctgtgaacctgaggctcagaacacaacctacctgtggtgggtaaatggtcagagc
ctcccagtcagtcccaggctgcagctgtccaatggcaacaggaccctcactctattcaat
gtcacaagaaatgacgcaagagcctatgtatgtggaatccagaactcagtgagtgcaaac
cgcagtgacccagtcaccctggatgtcctctatgggccggacacccccatcatttccccc
ccagactcgtcttacctttcgggagcgaacctcaacctctcctgccactcggcctctaac
ccatccccgcagtattcttggcgtatcaatgggataccgcagcaacacacacaagttctc
tttatcgccaaaatcacgccaaataataacgggacctatgcctgttttgtctctaacttg
gctactggccgcaataattccatagtcaagagcatcacagtctctgcatctggaacttct
cctggtctctcagctggggccactgtcggcatcatgattggagtgctggttggggttgct
ctgatatag
atggagagccccagcgcccccccccaccgctggtgcatcccctggcagcgcctgctgctg
accgccagcctgctgaccttctggaacccccccaccaccgccaagctgaccatcgagagc
acccccttcaacgtggccgagggcaaggaggtgctgctgctggtgcacaacctgccccag
cacctgttcggctacagctggtacaagggcgagcgcgtggacggcaaccgccagatcatc
ggctacgtgatcggcacccagcaggccacccccggccccgcctacagcggccgcgagata
atctaccccaacgccagcctgctgatccagaacatcatccagaacgacaccggcttctac
accctgcacgtgatcaagagcgacctggtgaacgaggaggccaccggccagttccgcgtg
taccccgagctgcccaagcccagcatcagcagcaacaacagcaagcccgtggaggacaag
gacgccgtggccttcacctgcgagcccgagacccaggacgccacctacctgtggtgggtg
aacaaccagagcctgcccgtgagcccccgcctgcagctgagcaacggcaaccgcaccctg
accctgttcaacgtgacccgcaacgacaccgccagctacaagtgcgagacccagaacccc
gtgagcgcccgccgcagcgacagcgtgatcctgaacgtgctgtacggccccgacgccccc
accatcagccccctgaacaccagctaccgcagcggcgagaacctgaacctgagctgccac
gccgccagcaacccccccgcccagtacagctggttcgtgaacggcaccttccagcagagc
acccaggagctgttcatccccaacatcaccgtgaacaacagcggcagctacacctgccag
gcccacaacagcgacaccggcctgaaccgcaccaccgtgaccaccatcaccgtgtacgcc
gagccccccaagcccttcatcaccagcaacaacagcaaccccgtggaggacgaggacgcc
gtggccctgacctgcgagcccgagatccagaacaccacctacctgtggtgggtgaacaac
cagagcctgcccgtgagcccccgcctgcagctgagcaacgacaaccgcaccctgaccctg
ctgagcgtgacccgcaacgacgtgggcccctacgagtgcggcatccagaacgagctgagc
gtggaccacagcgaccccgtgatcctgaacgtgctgtacggccccgacgaccccaccatc
agccccagctacacctactaccgccccggcgtgaacctgagcctgagctgccacgccgcc
agcaacccccccgcccagtacagctggctgatcgacggcaacatccagcagcacacccag
gagctgttcatcagcaacatcaccgagaagaacagcggcctgtacacctgccaggccaat
aacagcgccagcggccacagccgcaccaccgtgaagaccatcaccgtgagcgccgagctg
cccaagcccagcatcagcagcaacaacagcaagcccgtggaggacaaggacgccgtggcc
ttcacctgcgagcccgaggcccagaacaccacctacctgtggtgggtgaacggccagagc
ctgcccgtgagcccccgcctgcagctgagcaacggcaaccgcaccctgaccctgttcaac
gtgacccgcaacgacgcccgcgcctacgtgtgcggcatccagaacagcgtgagcgccaac
cgcagcgaccccgtgaccctggacgtgctgtacggccccgacacccccatcatttccccc
cccgacagcagctacctgagcggcgccaacctgaacctgagctgccacagcgccagcaac
cccagcccccagtacagctggcgcatcaacggcatcccccagcagcacacccaggtgctg
ttcatcgccaagatcacccccaacaacaacggcacctacgcctgcttcgtgagcaacctg
gccaccggccgcaacaacagcatcgtgaagagcatcaccgtgagcgccagcggcaccagc
cccggcctgagcgccggcgccaccgtgggcatcatgatcggcgtgctggtgggcgtggcc
ctgatatag
5' End
3' End
Notes
Expression VectorpVIJnsApVIJnsB
Assay MethodsELISAELISA
ResultsSignificant amount (from 1 x 106 injection: 1.9µg/L)High increase (10 fold increase from natural gene)
Protein FunctionGlycosylated cell surface intracellular adhesion molecule, human tumor marker
Recoding PurposeTo improve expression
Synthesized ByBIONEXUS (Oakland, CA, USA)
Recoding MethodThe natural gene was codon optimized based on the codon usage patterns of H. sapiens. A Kozak
sequence was also added to the gene.
Publication Author(s)Mennuni, C.; Calvaruso, F.; Facciabene, A.; Aurisicchio, L.; Storto, M.; Scarselli, E.; Ciliberto, G.; La Monica, N.
Corresponding AuthorNicola La Monica
Corresponding AddressIstituto di Ricerche di Biologia Molecolare (IRBM), Pomezia, Italy.
Publication Year2005
Publication TitleEfficient induction of T-cell responses to carcinoembryonic antigen by a heterologous prime-boost regimen using DNA and adenovirus vectors carrying a codon usage optimized cDNA
AbstractThe immunogenic properties of plasmid DNA and recombinant adenovirus (Ad) encoding the carcinoembryonic antigen (CEA) were examined in mice by measuring both the amplitude and type of immune response, and the immunogenicity of codon usage optimized cDNA encoding CEA (CEAopt) was assessed both in C57Bl/6 and CEA transgenic mice. Vectors were injected into quadriceps muscle either alone or in combination, and plasmid DNA was electroporated to enhance gene expression efficiency and immunogenicity. Injection of plasmid pVIJ/CEA followed by Ad-CEA boost elicited the highest amplitude of both CD4(+) and CD8(+) T-cell response to the target antigen, measured by both IFNgamma-ELIspot assay and intracellular staining. Vectors carrying cDNA of CEAopt expressed a greater amount of the CEA protein than their wild-type counterparts, and this enhanced expression was associated with greater immunogenicity. Both CD4(+) and CD8(+) T-cell epitopes were mapped in the C-terminal portion of the protein. In CEA transgenic mice, only immunization based on repeated injections of pVIJ/CEAopt followed by Ad-CEAopt was able to elicit a CEA-specific CD8(+) T-cell response, whereas the wild-type vectors did not break tolerance to this target antigen. MC38-CEA tumor cells injected s.c. in CEA transgenic mice vaccinated with CEAopt vectors exhibited delayed growth kinetics. These studies demonstrate that this type of genetic vaccine is highly immunogenic and can break tolerance to CEA tumor antigen in CEA transgenic mice. (c) 2005 Wiley-Liss, Inc.
JournalInt J Cancer. 117(3): 444-55.
SummaryMice (Mus musculus) were transformed with a recoded version of the CEA gene, CEAopt, in order to increase the expression of the carcinoembryonic antigen protein. CEA was codon optimized based on the codon usage patterns of Homo sapiens in order to attain CEAopt. Natural CEA produced a significant amount of carcinoembryonic antigen, but CEAopt was able to produce much more in all constructs used. With the success of the recoding, it can be said that this method will be used again.
CommentsThere was no accession number for the recoded gene provided by the article.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=533
PubMed ID15906358
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site