Synthetic Gene DataBase
 

Synthetic Gene 189


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID175189
GenBank AccessionNC_001802
GenBank GI9629357
Gene Namegag-polCO gag-pol
Gene Length (bp)43080
Specieshuman immunodeficiency virus (HIV1)Mus musculus
StrainsType 1mouse spleen cells
CDSatgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcaatcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtgatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtgcatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggagaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaggaaccctttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaattcagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagattgttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttaagggaagatctggccttc
ctacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccaga
agagagcttcaggtctggggtagagacaacaactccccctcagaagcaggagccgataga
caaggaactgtatcctttaacttccctcaggtcactctttggcaacgacccctcgtcaca
ataaagataggggggcaactaaaggaagctctattagatacaggagcagatgatacagta
ttagaagaaatgagtttgccaggaagatggaaaccaaaaatgatagggggaattggaggt
tttatcaaagtaagacagtatgatcagatactcatagaaatctgtggacataaagctata
ggtacagtattagtaggacctacacctgtcaacataattggaagaaatctgttgactcag
attggttgcactttaaattttcccattagccctattgagactgtaccagtaaaattaaag
ccaggaatggatggcccaaaagttaaacaatggccattgacagaagaaaaaataaaagca
ttagtagaaatttgtacagagatggaaaaggaagggaaaatttcaaaaattgggcctgaa
aatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaa
ttagtagatttcagagaacttaataagagaactcaagacttctgggaagttcaattagga
ataccacatcccgcagggttaaaaaagaaaaaatcagtaacagtactggatgtgggtgat
gcatatttttcagttcccttagatgaagacttcaggaagtatactgcatttaccatacct
agtataaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatgg
aaaggatcaccagcaatattccaaagtagcatgacaaaaatcttagagccttttagaaaa
caaaatccagacatagttatctatcaatacatggatgatttgtatgtaggatctgactta
gaaatagggcagcatagaacaaaaatagaggagctgagacaacatctgttgaggtgggga
cttaccacaccagacaaaaaacatcagaaagaacctccattcctttggatgggttatgaa
ctccatcctgataaatggacagtacagcctatagtgctgccagaaaaagacagctggact
gtcaatgacatacagaagttagtggggaaattgaattgggcaagtcagatttacccaggg
attaaagtaaggcaattatgtaaactccttagaggaaccaaagcactaacagaagtaata
ccactaacagaagaagcagagctagaactggcagaaaacagagagattctaaaagaacca
gtacatggagtgtattatgacccatcaaaagacttaatagcagaaatacagaagcagggg
caaggccaatggacatatcaaatttatcaagagccatttaaaaatctgaaaacaggaaaa
tatgcaagaatgaggggtgcccacactaatgatgtaaaacaattaacagaggcagtgcaa
aaaataaccacagaaagcatagtaatatggggaaagactcctaaatttaaactgcccata
caaaaggaaacatgggaaacatggtggacagagtattggcaagccacctggattcctgag
tgggagtttgttaatacccctcccttagtgaaattatggtaccagttagagaaagaaccc
atagtaggagcagaaaccttctatgtagatggggcagctaacagggagactaaattagga
aaagcaggatatgttactaatagaggaagacaaaaagttgtcaccctaactgacacaaca
aatcagaagactgagttacaagcaatttatctagctttgcaggattcgggattagaagta
aacatagtaacagactcacaatatgcattaggaatcattcaagcacaaccagatcaaagt
gaatcagagttagtcaatcaaataatagagcagttaataaaaaaggaaaaggtctatctg
gcatgggtaccagcacacaaaggaattggaggaaatgaacaagtagataaattagtcagt
gctggaatcaggaaagtactatttttagatggaatagataaggcccaagatgaacatgag
aaatatcacagtaattggagagcaatggctagtgattttaacctgccacctgtagtagca
aaagaaatagtagccagctgtgataaatgtcagctaaaaggagaagccatgcatggacaa
gtagactgtagtccaggaatatggcaactagattgtacacatttagaaggaaaagttatc
ctggtagcagttcatgtagccagtggatatatagaagcagaagttattccagcagaaaca
gggcaggaaacagcatattttcttttaaaattagcaggaagatggccagtaaaaacaata
catactgacaatggcagcaatttcaccggtgctacggttagggccgcctgttggtgggcg
ggaatcaagcaggaatttggaattccctacaatccccaaagtcaaggagtagtagaatct
atgaataaagaattaaagaaaattataggacaggtaagagatcaggctgaacatcttaag
acagcagtacaaatggcagtattcatccacaattttaaaagaaaaggggggattgggggg
tacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaatta
caaaaacaaattacaaaaattcaaaattttcgggtttattacagggacagcagaaatcca
ctttggaaaggaccagcaaagctcctctggaaaggtgaaggggcagtagtaatacaagat
aatagtgacataaaagtagtgccaagaagaaaagcaaagatcattagggattatggaaaa
cagatggcaggtgatgattgtgtggcaagtagacaggatgaggattag
5' End
3' End
NotesGenBank Accession No.is not provided by the authors. Thus, NC_001802 is used for a record.Contacted the corresponding author on 1/23/06 for the sequence. Awaiting reply.
Expression VectorpCIpCI
Assay MethodsIFN-gamma staining, FACScan using CellQuest software.IFN-gamma staining, FACScan using CellQuest software.
ResultsUndetectable.Increased expression.
Protein Function
Recoding PurposeTo improve expression
Synthesized ByOxford Biomedica
Recoding MethodCodon optimized for mammalian usage.
Publication Author(s)Singh, R. A.; Barry, M. A.
Corresponding AuthorMichael A. Barry
Corresponding AddressCenter for Cell and Gene Therapy. Baylor College of Medicine, Houston, TX 77030, USA.
Publication Year2004
Publication TitleRepertoire and immunofocusing of CD8 T cell responses generated by HIV-1 gag-pol and expression library immunization vaccines
AbstractSeveral gene-based vaccine approaches are being tested to drive multivalent cellular immune responses to control HIV-1 viral variants. To compare the utility of these approaches, HLA-A*0201 transgenic mice were genetically immunized with plasmids encoding wild-type (wt) gag-pol, codon-optimized (CO) gag-pol, and an expression library immunization (ELI) vaccine genetically re-engineered to express non-CO fragments of gag and pol fused to ubiquitin for proteasome targeting. Equimolar delivery of each vaccine into HLA-A*0201 transgenic mice generated CD8 T cell responses, with the ELI vaccine producing up to 10-fold higher responses than the wt or CO gag-pol plasmids against cognate and mutant epitopes. All three vaccines generated multivalent CD8 responses against varying numbers of epitopes after priming. However, when the animals were immunized again, the wt and CO gag-pol vaccines boosted only the responses against a subset of epitopes and attenuated the responses against all other Ags including epitopes from clade and drug-resistant viral variants. In contrast, the ELI vaccine boosted CD8 responses against all of the gag-pol Ags and against mutant epitopes from clade and drug-resistant variants. These data suggest that HIV-1 vaccines expressing structurally intact gag and pol proteins drive immunofocused CD8 responses that reduce the repertoire of T cell responses. In contrast, the genetically re-engineered ELI vaccine appears to better maintain the multivalent CD8 responses that may be required to control HIV-1 viral variants.
JournalJ Immunol. 173(7): 4387-93.
SummaryThe goal of this study is to test the hypothesis that the expression library immunization (ELI) vaccine should mediate enhanced multivalent CD8T cell responses compared with unmodified gag-pol Ags. Direct comparison between the non codon-optimized ELI vaccine and plasmids expressing either non codon-optimized gag-pol or codon-optimized gag-pol was made. Experimental results showed that ELI vaccine generated CD8 responses 2-10-fols higher that wt gag-pol and slightly higher than codon-optimized gag-pol vaccine. In delivering similar amounts of each epitope by each vaccine, ELI vaccine generated highest responses, which against all of the gag-pol Ags.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=624
PubMed ID15383568
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site