Synthetic Gene DataBase
 

Synthetic Gene 19


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID1519
GenBank AccessionL20092
GenBank GI309745
Gene NameMSP-1pSMSP-1
Gene Length (bp)10651
SpeciesPlasmodium falciparumMus musculus
StrainsFVOVM92 (melanoma cells)
CDSgcagtaactccttccgtaattgataacatactttctaaaattgaaaatgaatatgaggtt
ttatatttaaaacctttagcaggtgtttatagaagtttaaaaaaacaattagaaaataac
gttatgacatttaatgttaatgttaaggatattttaaattcacgatttaataaacgtgaa
aatttcaaaaatgttttagaatcagatttaattccatataaagatttaacatcaagtaat
tatgttgtcaaagatccatataaatttcttaataaagaaaaaagagataaattcttaagc
agttataattatattaaggattcaatagatacggatataaattttgcaaatgatgttctt
ggatattataaaatattatccgaaaaatataaatcagatttagattcaattaaaaaatat
atcaacgacaaacaaggtgaaaatgagaaataccttccctttttaaacaatattgagacc
ttatataaaacagttaatgataaaattgatttatttgtaattcatttagaagcaaaagtt
ctaaattatacatatgagaaatcaaacgtagaagttaaaataaaagaacttaattactta
aaaacaattcaagacaaattggcagattttaaaaaaaataacaatttcgttggaattgct
gatttatcaacagattataaccataataacttattgacaaagttccttagtacaggtatg
gtttttgaaaatcttgctaaaaccgttttatctaatttacttgatggaaacttgcaaggt
atgttaaacatttcacaacaccaatgcgtaaaaaaacaatgtccacaaaattctggatgt
ttcagacatttagatgaaagagaagaatgtaaatgtttattaaattacaaacaagaaggt
gataaatgtgttgaaaatccaaatcctacttgtaacgaaaataatggtggatgtgatgca
gatgccaaatgtaccgaagaagattcaggtagcaacggaaagaaaatcacatgtgaatgt
actaaacctgattcttatccacttttcgatggtattttctgcagt
5' End
3' End
NotesNo sequence for wild-type MSP1 gene was given. So L20092 in GenBank was include for reference. CAI values were calculated with highly expressed human genes defined in Haas 1996 as the reference set. No synthetic gene sequence published. The authors were emailed on 9/6/5. But the email was invalid.
Expression VectorVR1020VR1020
Assay MethodsSDS-PAGE and Western BlotSDS-PAGE and Western Blot
ResultsDetectable protein expressionSignificant higher expression
Protein Functionmerozoite surface protein 1 (MSP-1)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodHuman most abundant codons (CUTG) were used for every amino acid except Ser (UCC rather than AGC).
Publication Author(s)Narum, D. L.; Kumar, S.; Rogers, W. O.; Fuhrmann, S. R.; Liang, H.; Oakley, M.; Taye, A.; Sim, B. K.; Hoffman, S. L.
Corresponding AuthorStephen L. Hoffman
Corresponding AddressEntreMed, Inc., Rockville, Maryland, USA.
Publication Year2001
Publication TitleCodon optimization of gene fragments encoding Plasmodium falciparum merzoite proteins enhances DNA vaccine protein expression and immunogenicity in mice
AbstractIn contrast to conventional vaccines, DNA and other subunit vaccines exclusively utilize host cell molecules for transcription and translation of proteins. The adenine plus thymine content of Plasmodium falciparum gene sequences (approximately 80%) is much greater than that of Homo sapiens (approximately 59%); consequently, codon usage is markedly different. We hypothesized that modifying codon usage of P. falciparum genes encoded by DNA vaccines from that used by the parasite to those resembling mammalian codon usage would lead to increased P. falciparum protein expression in vitro in mouse cells and increased antibody responses in DNA-vaccinated mice. We synthesized gene fragments encoding the receptor-binding domain of the 175-kDa P. falciparum erythrocyte-binding protein (EBA-175 region II) and the 42-kDa C-terminal processed fragment of the P. falciparum merozoite surface protein 1 (MSP-1(42)) using the most frequently occurring codon in mammals to code for each amino acid, and inserted the synthetic genes in DNA vaccine plasmids. In in vitro transient-expression assays, plasmids containing codon-optimized synthetic gene fragments (pS plasmids) showed greater than fourfold increased protein expression in mouse cells compared to those containing native gene fragments (pN plasmids). In mice immunized with 0.5, 5.0, or 50 microg of the DNA plasmids, the dose of DNA required to induce equivalent antibody titers was 10- to 100-fold lower for pS than for pN plasmids. These data demonstrate that optimizing codon usage in DNA vaccines can improve protein expression and consequently the immunogenicity of gene fragments in DNA vaccines for organisms whose codon usage differs substantially from that of mammals.
JournalInfect Immun. 69(12): 7250-3.
SummaryTwo malaria vaccine candidate antigens were fully codon optimized for expression in mammalian cells using human codon preference determined based on CUTG data. Both synthetic genes exhibited significant stronger expression than their wild-type counterparts.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=527
PubMed ID11705894
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site