Synthetic Gene DataBase
 

Synthetic Gene 190


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID176190
GenBank AccessionAF544010AX457086
GenBank GI2746488121715863
Gene Namegag (Du422 gag)gag (Du422-hugag)
Gene Length (bp)14791746
Specieshuman immunodeficiency virus (HIV1)Homo sapiens, Mus musculus
StrainsType 1BHK, VERO cells,& mouse spleen cells
CDSatgggtgcgagagcgtcaatattaagaggggaaaaattagataaatgggaaaaaattagg
ttaaggccagggggaaagaaacattatatgttaaaacacatagtatgggcaagcagggag
ctggaaagatttgcacttaaccctggccttttagaaacatcagaaggatgtaaacaaata
atgaaacagctacaaccagctctccagacaggaacagaggaacttaaatcattatacaac
acagtagcaactctctattgtgtacatgaaaagatagaagtacgagacaccaaggaagcc
ttagataagatagaggaagaacaaaacaaatgtcagcaaaaaacgcagcaggcaaaagcg
gctgacgggaaagtcagtcaaaattatcctatagtgcagaatctccaagggcaaatggta
catcaagccatatcacctagaaccttgaatgcatgggtaaaagtaatagaagaaaaggct
tttagcccagaggtaatacccatgtttacagcattatcagaaggagccaccccacaagat
ttaaacaccatgttaaatacagtggggggacatcaagcagccatgcaaatgttaaaagat
actattaatgaagaggctgcagaatgggatagagtacatccagtccatgcggggcctatt
gcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactactagtaccctt
caggaacaaatagcatggatgacaagtaacccacctattccagtgggagacatctataaa
agatggataattctggggttaaataaaatagtgagaatgtatagcccggtcagcattttg
gacataagacaagggccaaaggaaccctttcgagactatgtagatcggttctttaaaact
ttaagagctgaacaagctacacaagaagtaaaaaattggatgacagacaccttgttagtc
caaaatgcgaacccagattgtaagaccattttgagagcattaggaccaggggctacatta
gaagaaatgatgacagcatgtcaaggggtgggaggacctggtcacaaagcaagagtattg
gctgaggcaatgagtcaagcaaacagtggaaacataatgatgcagagaagcaattttaaa
ggccctagaagaattgttaaatgttttaactgtggcaaggaagggcacatagccagaaat
tgcagagcccctaggaaaaaaggctgttggaaatgtggaaaggaaggacaccaaatgaaa
gactgtactgaaaggcaggctaattttttagggaaaatttggccttcccacaaggggagg
ccagggaatttccttcagaacagaccagagccaacagccccaccagcagagagcttcagg
ttcgaagagacaacccccgctccgaaacaggagccgatagaaagggaacccttaacttcc
ctcaaatcactctttggcagcgaccccttgtctcaataa
atggctgctcgcgcatctatcctcagaggcgaaaagttggataagtgggaaaaaatcaga
ctcaggccaggaggtaaaaaacactacatgctgaagcatatcgtgtgggcatctagggag
ttggagagatttgcactgaaccccggactgctggaaacctcagagggctgtaagcaaatc
atgaaacagctccaaccagccttgcagaccggaacagaagagctgaagtccctttacaat
accgtggcaaccctctattgcgtccacgagaagatcgaggtgagagacacaaaggaggcc
ctggacaaaatcgaggaggagcagaataagtgccagcagaagacccagcaggcaaaggct
gctgacggaaaggtctctcagaactatcctatcgttcagaaccttcaggggcagatggtg
caccaagcaatcagccctagaaccctgaacgcatgggtgaaggtgatcgaggagaaagcc
ttttctcccgaggttatccccatgtttaccgccctgagcgaaggcgccactcctcaagac
ctgaacactatgctgaacacagtgggaggacaccaggccgctatgcagatgttgaaggat
accatcaacgaggaggcagccgaatgggaccgcctccaccccgtgcacgccggacctatc
gcccccggacaaatgagagaacctcgcggaagtgatattgccggtactaccagcaccctt
caagagcagattgcttggatgaccagcaacccacccatcccagtgggcgatatttacaaa
aggtggattattctggggctgaacaaaattgtgagaatgtactcccccgtctccatcctc
gacatccgccaaggacccaaggagccttttagggattacgtggacagattcttcaaaacc
cttagagctgagcaagccactcaggaggttaagaactggatgacagatactctgctcgtg
caaaacgctaaccccgattgcaaaaccatcttgagagctctcggtccaggtgccaccctt
gaggaaatgatgacagcatgtcaaggcgtgggaggacctgggcacaaggccagagttctc
gctgaggccatgagccagacaaactcaggcaatatcatgatgcagaggagtaactttaag
ggtcccaggagaatcgtcaagtgcttcaattgtggcaaggagggtcacattgccaggaac
tgccgcgcccccaggaagaaaggctgctggaagtgtggcaaagagggccaccagatgaag
gattgcaccgagcgccaagcaaacttcctgggaaagatttggcccagtcataagggccgc
cctggcaacttccttcaaaacagacccgagcctaccgccccccccgctgagtctttcaga
tttgaggagaccacccccgctccaaagcaggagccaattgagagagagcctctcaccagt
ctcaaaagcctctttggtagcgaccccctcagccaataagaattctagcttggcgtaatc
atggtcatagctgtttcctgtgtgaaattgttatcagctcacaattccacacaacatacg
agccggaagcataaagtgtaaagcctgggatgcctaatgagtgagctaactcacattagt
tgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctccattagtg
aatcgtccaacgcacggggagaggcggtttgcgtattgggcgcacttccgcttcctcgct
cactga
5' Endgggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccaatcacgacgt
tgtaaaacgacagccaatgaattgaagctt
3' Endcactgactcgctgcgctcgttcgttcggctgcggcgagccgtatcagctcactcaaaggc
ggtaatacggttatc
Notes
Expression VectorpERKpERK
Assay MethodsELISA, Western BlotELISA, Western Blot
ResultsEnhanced expressionDid not enhance expression.
Protein FunctionDNA binding ( GO:0003677 ), RNA binding ( GO: 0003723), RNA-directed DNA polymerase activity ( GO: 0003964)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodOptimization of codons used for VRP expression in human cells.
Publication Author(s)Williamson, C.; Morris, L.; Maughan, M. F.; Ping, L. H.; Dryga, S. A.; Thomas, R.; Reap, E. A.; Cilliers, T.; van Harmelen, J.; Pascual, A.; Ramjee, G.; Gray, G.; Johnston, R.; Karim, S. A.; Swanstrom, R.
Corresponding AuthorCarolyn Williamson
Corresponding AddressDivision of Medical Virology, University of Cape Town, Observatory, Cape Town, South Africa 7925. cwilliam@curie.uct.ac.za
Publication Year2003
Publication TitleCharacterization and selection of HIV-1 subtype C isolates for use in vaccine development
AbstractHIV-1 genetic diversity among circulating strains presents a major challenge for HIV-1 vaccine development, particularly for developing countries where less sequence information is available. To identify representative viruses for inclusion in candidate vaccines targeted for South Africa, we applied an efficient sequence survey strategy to samples from recently and chronically infected persons residing in potential vaccine trial sites. All 111 sequences were subtype C, including 30 partial gag, 26 partial pol, 27 V2-V3 env, and 28 V5-partial gp41 sequences. Of the 10 viruses cultured from recently infected individuals, 9 were R5 and 1 was R5X4. Two isolates, Du151 and Du422, collected within 2 months of infection, were selected as vaccine strains on the basis of their amino acid similarity to a derived South African consensus sequence The selection of recently transmitted R5 isolates for vaccine design may provide an advantage in a subtype C R5-dominant epidemic. The full-length Du422 gag and Du151 pol and env genes were cloned into the Venezuelan equine encephalitis (VEE) replicon particle (VRP) expression system. Du422 Gag protein expressed from the VRP accumulated to a high level and was immunogenic as demonstrated by cytotoxic T lymphocyte responses in mice vaccinated with gag-VRPs. Optimization of codon use for VRP expression in human cells did not enhance expression of the gag gene. The cloned Du151 env gene encoded a functional protein as demonstrated by fusion of VRP-infected cells with cells expressing CD4 and CCR5. Genes identified in this study have been incorporated into the VEE VRP candidate vaccines targeted for clinical trial in South Africa.
JournalAIDS Res Hum Retroviruses. 19(2): 133-44.
SummaryTo identify representative viruses for inclusion in candidate vaccines targeted for South Africa, the full length of Du422 gag and Du151 pol and env genes were synthesized and cloned into VEE replleon particle (VRP) expression system. Du422 hu-gag was also synthesized for optimization of codon used for VRP expression in human cells. BHK and VERO cells were infected with Du422 gag VRPs or with Du422hu-gag VRPs. Du422 gag expressed in a high level and was immunogenic. However, Du422hu-gag did not enhance expression of the gag gene.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=644
PubMed ID12639249
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site