Synthetic Gene DataBase
 

Synthetic Gene 191


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID177191
GenBank AccessionU63632
GenBank GI1465777
Gene Nameenv (JRFL)env (JRFL)
Gene Length (bp)25440
Specieshuman immunodeficiency virus (HIV1)Homo sapiens, Mus musculus
StrainsType 1human PBMCS, RD cells, mouse spleen cells.
CDSatgagagtgaaggggatcaggaagagttatcagtacttgtggaaagggggcaccttgctc
cttgggatattaatgatctgtagtgctgtagaaaagttgtgggtcacagtctattatggg
gtacctgtgtggaaagaagcaaccaccactctattttgtgcatcagatgctaaagcatat
gatacagaggtacataatgtttgggccacacatgcctgtgtacccacagaccccaaccca
caagaagtagtattggaaaatgtaacagaacattttaacatgtggaaaaataacatggta
gaacagatgcaggaggatataatcagtttatgggatcaaagcctaaagccatgtgtaaaa
ttaaccccactctgtgttactttaaattgcaaggatgtgaatgctactaataccactaat
gatagcgagggaacgatggagagaggagaaataaaaaactgctctttcaatatcaccaca
agcataagagatgaggtgcagaaagaatatgctcttttttataaacttgatgtagtacca
atagataataataataccagctataggttgataagttgtgacacctcagtcattacacag
gcctgtccaaagatatcctttgagccaattcccatacattattgtgccccggctggtttt
gcgattctaaagtgtaatgataagacgttcaatggaaaaggaccatgtaaaaatgtcagc
acagtacaatgtacacatggaattaggccagtagtatcaactcaactgctgctaaatggc
agtctagcagaagaagaggtagtaattagatctgacaatttcacgaacaatgctaaaacc
ataatagtacagctgaaagaatctgtagaaattaattgtacaagacccaacaacaataca
agaaaaagtatacatataggaccagggagagcattttatactacaggagaaataatagga
gatataagacaagcacattgtaacattagtagagcaaaatggaatgacactttaaaacag
atagttataaaattaagagaacaatttgagaataaaacaatagtctttaatcactcctca
ggaggggacccagaaattgtaatgcacagttttaattgtggaggagaatttttctactgt
aattcaacacaactgtttaatagtacttggaataataatactgaagggtcaaataacact
gaaggaaatactatcacactcccatgcagaataaaacaaattataaacatgtggcaggaa
gtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgttcatcaaatatt
acagggctgctattaacaagagatggtggtattaatgagaatgggaccgagatcttcaga
cctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagta
aaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcaaagagaa
aaaagagcagtgggaataggagctgtgttccttgggttcttgggagcagcaggaagcact
atgggcgcagcgtcaatgacactgacggtacaggccagactattattgtctggtatagtg
caacagcagaacaatttgctgagggctattgaggcgcaacagcgtatgttgcaactcaca
gtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaggggat
caacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgcct
tggaatgctagttggagtaataaatctctggataggatttggaataacatgacctggatg
gagtgggaaagagaaattgacaattacacaagcgaaatatacaccctaattgaagaatcg
cagaaccaacaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttg
tggaattggtttgacataacaaaatggctgtggtatataaaaatattcataatgatagta
ggaggcttagtaggtttaagactagtttttactgtactttctatagtgaatagagttagg
cagggatactcaccattatcgtttcagaccctcctcccagccccgaggggacccgacagg
cccgaaggaatcgaagaagaaggtggagagagagacagagacagatccggacgattagtg
aacggattcttagcacttatctgggtcgacctgcggagcctgtgcctcttcagctaccac
cgcttgagagacttactcttgactgtaacgaggattgtggaacttctgggacgcaggggg
tgggaagtcctgaaatattggtggaatctcctacagtattggagtcaggaactaaagaat
agtgctgttagcttgctcaatgccacagccatagcagtagctgaggggacagataggatt
atagaagcattacaaagaacttatagagctattctccacatacctacaagaataagacag
ggcttggaaagggctttgctataa
5' End
3' End
NotesIt was not used in the experiment.Contacted authors for the sequence on 1/29/06.
Expression VectorEnvelope glycoprotein
Assay MethodsELISA, Western Blot, ELISPOT
ResultsIn the experiments, it was used as a control.
Protein Functionenvelope glycoprotein
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodOptimized for human codon usage.
Publication Author(s)Muthumani, K.; Zhang, D.; Dayes, N. S.; Hwang, D. S.; Calarota, S. A.; Choo, A. Y.; Boyer, J. D.; Weiner, D. B.
Corresponding AuthorDavid B. Weiner
Corresponding AddressDepartment of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA.
Publication Year2003
Publication TitleNovel engineered HIV-1 East African Clade-A gp160 plasmid construct induces strong humoral and cell-mediated immune responses in vivo
AbstractHIV-1 sequences are highly diverse due to the inaccuracy of the viral reverse transcriptase. This diversity has been studied and used to categorize HIV isolates into subtypes or clades, which are geographically distinct. To develop effective vaccines against HIV-1, immunogens representing different subtypes may be important for induction of cross-protective immunity, but little data exist describing and comparing the immunogenicity induced by different subtype-based vaccines. This issue is further complicated by poor expression of HIV structural antigens due to rev dependence. One costly approach is to codon optimize each subtype construct to be examined. Interestingly, cis-acting transcriptional elements (CTE) can also by pass rev restriction by a rev independent export pathway. We reasoned that rev+CTE constructs might have advantages for such expression studies. A subtype A envelope sequence from a viral isolate from east Africa was cloned into a eukaryotic expression vector under the control of the CMV-IE promoter. The utility of inclusion of the Mason-Pfizer monkey virus (MPV)-CTE with/without rev for driving envelope expression and immunogenicity was examined. Expression of envelope (gp120) was confirmed by immunoblot analysis and by pseudotype virus infectivity assays. The presence of rev and the CTE together increased envelope expression and viral infection. Furthermore the CTE+rev construct was significantly more immunogenic then CTE alone vector. Isotype analysis and cytokine profiles showed strong Th1 response in plasmid-immunized mice, which also demonstrated the superior nature of the rev+CTE construct. These responses were of similar or greater magnitude to a codon-optimized construct. The resulting cellular immune responses were highly cross-reactive with a HIV-1 envelope subtype B antigen. This study suggests a simple strategy for improving the expression and immunogenicity of HIV subtype-specific envelope antigens as plasmid or vector-borne immunogens.
JournalVirology. 314(1): 134-46.
SummaryA HIV-1 subtype A envelope plasmids EAC-1 , which contains a combination of CTE and rev and EAC-2, which contains CTE only were constructed to induce strong humoral and cell-mediated immune responses in vivo. Codon-optimized subtype B (JR-FL ) DNA was used in all the experiments as a positive and specific control. It was optimized for human codon usage. The experimental results showed that EAC-1 and EAC-2 increased envelope expression and viral infection. EAC-1 was more immunogenic than EAC_2. The humonral and cell-mediated immune responses were similar or in some results, greater than codon-optimized construct.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=637
PubMed ID14517067
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site