Synthetic Gene DataBase
 

Synthetic Gene 193


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID179193
GenBank AccessionD55633
GenBank GI862333
Gene NameE2E2
Gene Length (bp)11580
SpeciesCanine oral papillomavirusCanis familiaris
Strains293, T rex, Dogs' PBMCs
CDSatggagaaactcagcgaggccttagacttactgcaagaggaactactgagtctgtatgag
cagaatagccaaagtcttgcagaccaatcaaggcactggtcattgctcagaaaagagcaa
gtcctactttattatgccagaggcaagggcataatgaggataggcatgcagcctgtgcct
ccacagtctgtgtctcaagccaaagctaagcaggccatagagcagtcactttacatagac
agcttgttacactcaaagtatgcaaatgaaccgtggacactatgcgatacaagcagggag
aggttggttgcagaacctgcatacaccttcaaaaaaggtggaaagcagattgatgtcaga
tatggtgacagtgaggaaaacattgtcagatatgtattgtggctggatatctattaccag
gatgagtttgacacctgggaaaaagcacatggcaagctagatcacaaaggactctcatac
atgcatgggactcagcaggtgtattatgtggactttgaagaggaggccaacaaatatagc
gagactgggaaatatgagattctaaaccaacccactactattcccaccaccagtgccgcc
ggaacctccggaccggaactccccggtcactccgcctcggggtccggtgcctgttccctt
acccccaggaaagggccgtcacggcggcctggacggaggtcgtcgcggttccccagaagg
tcaggaggacgaggaagactcggacgaggaggaagcggagaattacccccccagccgcag
ccgtcctcgtcgtggtcgccgccgtctccacaacaagtgggatcaaaacatcaactacga
accaccagcagcgccggaggacgactgggaagacttctgcaagaagcttacgatccccca
gttcttgttttagctggggatcctaatagtttaaaatgcataagatatagattaagtcat
aagcatagggggttatatttgggggccagcacgacgtggaaatggacatcaggcggggat
ggagcatctaagcatgaccggggcagtgcgcggatgctgttagcatttttaagtgatcaa
caacgggaggactttatggacagagtgacttttcctaagtctgtgcgagtatttcgggga
gggttagatgagttataa
5' End
3' End
NotesWT was not used in the experiments.Contacted author on 1/24/06 for seq.
Expression VectorV1Jns
Assay MethodsWestern Blot, ELISA, IFN-gamma.
ResultsPositive.
Protein FunctionRegulation.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodUsed codons that are preferred for highly expressed genes in mammalian cells
Publication Author(s)Johnston, K. B.; Monteiro, J. M.; Schultz, L. D.; Chen, L.; Wang, F.; Ausensi, V. A.; Dell, E. C.; Santos, E. B.; Moore, R. A.; Palker, T. J.; Stanley, M. A.; Jansen, K. U.
Corresponding AuthorKimberly B.Johnston
Corresponding AddressVaccines and Biologics Research, Merck Research Laboratories, West Point, PA 19486, USA. kimberly_johnston@merck.com
Publication Year2005
Publication TitleProtection of beagle dogs from mucosal challenge with canine oral papillomavirus by immunization with recombinant adenoviruses expressing codon-optimized early genes
AbstractReplication-deficient adenoviral (rAd5) vaccines containing codon-optimized E1, E2, E4, and E7 genes of canine oral papillomavirus (COPV) were tested singly or in combination to determine which vaccines could protect against mucosal challenge with COPV. In three studies, groups of 4-6 beagle dogs were immunized subcutaneously (s.c.) with 10(11) rAd5 at 8-10 weeks and 4-6 weeks prior to challenge with infectious COPV particles at multiple oral mucosal sites. Control dogs were immunized with equivalent doses of rAd5 expressing human papillomavirus (HPV) type 16 L1 (rAd5-HPV-16 L1). In the first study, complete protection from COPV-induced papillomas was achieved by immunization with rAd5 vaccine combinations expressing either E1 + E2 or E1 + E2 + E4 + E7; whereas two of six dogs immunized with rAd5-E4 + rAd5-E7 and six of six rAd5-HPV16-L1-immunized control dogs developed oral papillomas. In two subsequent studies, rAd5-E1 and rAd5-E2 vaccines were tested singly or in combination to assess levels of protective immunity to COPV challenge. Subcutaneous immunization with either one or two doses of rAd5 expressing the COPV E1 and E2 genes could protect > 90% of challenged dogs from wart formation. In contrast, all eight dogs immunized with rAd5-HPV-16 L1 developed papillomas at multiple sites. Protection was accompanied by significant IFN-gamma responses to COPV E1 and E2 peptides. Partial protection was conferred by two immunizations with either rAd5-E1 (6 of 9 protected) or rAd5-E2 (8 of 9 protected). These data indicate that rAd5 expressing papillomavirus E1 and E2 proteins can induce strong protective responses even in outbred populations under practical immunization conditions.
JournalVirology. 336(2): 208-18.
SummaryThe goal of the study is to prevent disease in beagle dogs challenged at mucosal sites with COPV. Altogether sixty beagle dogs were immunized with recombinant adenoviruses expressing codon-optimized early genes E1, E2, E4, and E7. For each protein, a synthetic gene encoding the wild type amino acid sequences was designed using codons that are preferred for highly expressed genes in mammalian cells. Replication-deficient adenoviral (rAd5) expressing HIV-16 L1 vaccine was used as control. Dogs immunized subcutaneously with either one or two doses of rAd5 expressing the COPV E1 and E2 genes could protect >90 % from wart development.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=627
PubMed ID15892962
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site