Synthetic Gene DataBase
 

Synthetic Gene 197


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID183197
GenBank AccessionAF217189DQ289492
GenBank GI672423782880266
Gene NameepoBepoB(SYN)
Gene Length (bp)42334293
SpeciesPolyangium cellulosum (Sorangium cellulosum)Escherichia coli
StrainsSMP44K207-3
CDSatgacgatcaatcagcttctgaacgagctcgagcaccagggtgtcaagctggcggccgat
ggggagcgcctccagatacaggcccccaagaacgccctgaacccgaacctgctcgctcga
atctccgagcacaaaagcacgatcctgacgatgctccgtcagagactccccgcagagtcc
atcgtgcccgccccagccgagcggcacgttccgtttcctctcacagacatccaaggatcc
tactggctgggtcggacaggagcgtttacggtccccagcgggatccacgcctatcgcgaa
tacgactgtacggatctcgacgtggcgaggctgagccgcgcctttcggaaagtcgtcgcg
cggcacgacatgcttcgggcccacacgctgcccgacatgatgcaggtgatcgagcctaaa
gtcgacgccgacatcgagatcatcgatctgcgcgggctcgaccggagcacacgggaagcg
aggctcgtatcgttgcgagatgcgatgtcgcaccgcatctatgacaccgagcgccctccg
ctctatcacgtcgtcgccgttcggctggacgagcagcaaacccgtctcgtgctcagtatc
gatctcattaacgttgacctaggcagcctgtccatcatcttcaaggattggctcagcttc
tacgaagatcccgagacctctctccctgtcctggagctctcgtaccgcgactatgtgctc
gcgctggagtctcgcaagaagtctgaggcgcatcaacgatcgatggattactggaagcgg
cgcgtcgccgagctcccacctccgccgatgcttccgatgaaggccgatccatctaccctg
agggagatccgcttccggcacacggagcaatggctgccgtcggactcctggagtcgattg
aagcagcgtgtcggggagcgcgggctgaccccgacgggcgtcattctggctgcattttcc
gaggtgatcgggcgctggagcgcgagcccccggtttacgctcaacataacgctcttcaac
cggctccccgtccatccgcgcgtgaacgatatcaccggggacttcacgtcgatggtcctc
ctggacatcgacaccactcgcgacaagagcttcgaacagcgcgctaagcgtattcaagag
cagctgtgggaagcgatggatcactgcgacgtaagcggtatcgaggtccagcgagaggcc
gcccgggtcctggggatccaacgaggcgcattgttccccgtggtgctcacgagcgcgctc
aaccagcaagtcgttggtgtcacctcgctgcagaggctcggcactccggtgtacaccagc
acgcagactcctcagctgctgctggatcatcagctctacgagcacgatggggacctcgtc
ctcgcgtgggacatcgtcgacggagtgttcccgcccgaccttctggacgacatgctcgaa
gcgtacgtcgcttttctccggcggctcactgaggaaccatggagtgaacagatgcgctgt
tcgcttccgcctgcccagctagaagcgcgggcgagcgcaaacgagaccaactcgctgctg
agcgagcatacgctgcacggcctgttcgcggcgcgggtcgagcagctgcctatgcagctc
gccgtggtgtcggcgcgcaagacgctcacgtacgaagagctttcgcgccgttcgcggcga
cttggcgcgcggctgcgcgagcagggggcacgcccgaacacattggtcgcggtggtgatg
gagaaaggctgggagcaggttgtcgcggttctcgcggtgctcgagtcaggcgcggcctac
gtgccgatcgatgccgacctaccggcggagcgtatccactacctcctcgatcatggtgag
gtaaagctcgtgctgacgcagccatggctggatggcaaactgtcatggccgccggggatc
cagcggctgctcgtgagcgatgccggcgtcgaaggcgacggcgaccagcttccgatgatg
cccattcagacaccttcggatctcgcgtatgtcatctacacctcgggatccacagggttg
cccaagggggtgatgatcgatcatcggggtgccgtcaacaccatcctggacatcaacgag
cgcttcgaaatagggcccggagacagagtgctggcgctctcctcgctgagcttcgatctc
tcggtctacgatgtgttcgggatcctggcggcgggcggtacgatcgtggtgccggacgcg
tccaagctgcgcgatccggcgcattgggcagcgttgatcgaacgagagaaggtgacggtg
tggaactcggtgccggcgctgatgcggatgctcgtcgagcattccgagggtcgccccgat
tcgctcgctaggtctctgcggctttcgctgctgagcggcgactggatcccggtgggcctg
cctggcgagctccaggccatcaggcccggcgtgtcggtgatcagcctgggcggggccacc
gaagcgtcgatctggtccatcgggtaccccgtgaggaacgtcgatccatcgtgggcgagc
atcccctacggccgtccgctgcgcaaccagacgttccacgtgctcgatgaggcgctcgaa
ccgcgcccggtctgggttccggggcaactctacattggcggggtcggactggcactgggc
tactggcgcgatgaagagaagacgcgcaacagcttcctcgtgcaccccgagaccggggag
cgcctctacaagaccggcgatctgggccgctacctgcccgatggaaacatcgagttcatg
gggcgggaggacaaccaaatcaagcttcgcggataccgcgttgagctcggggaaatcgag
gaaacgctcaagtcgcatccgaacgtacgcgacgcggtgattgtgcccgtcgggaacgac
gcggcgaacaagctccttctagcctatgtggtcccggaaggcacacggagacgcgctgcc
gagcaggacgcgagcctcaagaccgagcgggtcgacgcgagagcacacgccgccaaagcg
gacggattgagcgacggcgagagggtgcagttcaagctcgctcgacacggactccggagg
gatctggacggaaagcccgtcgtcgatctgaccgggctggttccgcgggaggcggggctg
gacgtctacgcgcgtcgccgtagcgtccgaacgttcctcgaggccccgattccatttgtt
gaattcggccgattcctgagctgcctgagcagcgtggagcccgacggcgcggcccttccc
aaattccgttatccatcggctggcagcacgtacccggtgcaaacctacgcgtacgccaaa
tccggccgcatcgagggcgtggacgagggcttctattattaccacccgttcgagcaccgt
ttgctgaaggtctccgatcacgggatcgagcgcggagcgcacgttccgcaaaacttcgac
gtgttcgatgaagcggcgttcggcctcctgttcgtgggcaggatcgatgccatcgagtcg
ctgtatggatcgttgtcacgagaattctgcctgctggaggccggatatatggcgcagctc
ctgatggagcaggcgccttcctgcaacatcggcgtctgtccggtgggtcaattcgatttt
gaacaggttcggccggttctcgacctgcggcattcggacgtttacgtgcacggcatgctg
ggcgggcgggtagacccgcggcagttccaggtctgtacgctcggtcaggattcctcaccg
aggcgcgccacgacgcgcggcgcccctcccggccgcgatcagcacttcgccgatatcctt
cgcgacttcttgaggaccaaactacccgagtacatggtgcctacagtcttcgtggagctc
gatgcgttgccgctgacgtccaacggcaaggtcgatcgtaaggccctgcgcgagcggaag
gatacctcgtcgccgcggcattcggggcacacggcgccacgggacgccttggaggagatc
ctcgttgcggtcgtacgggaggtgctcgggctggaggtggttgggctccagcagagcttc
gtcgatcttggtgcgacatcgattcacatcgttcgcatgaggagtctgttgcagaagagg
ctggatagggagatcgccatcaccgagttgttccagtacccgaacctcggctcgctggcg
tccggtttgcgccgagactcgaaagatctagagcagcggccgaacatgcaggaccgagtg
gaggctcggcgcaagggcaggagacgtagctaa
atgaccattaatcagttactgaatgaattagaacaccagggcgttaaattagccgcagat
ggggagcgcctccagattcaggcaccaaaaaatgccctgaacccgaacttgttagcacgc
atttctgaacataaatccacgatcttaaccatgctgcgccagcgccttccggcggagtct
attgtcccagccccagcggaacggcatgtgccgttccctctgaccgacatccagggctct
tattggctcggtcgtactggtgcctttacggttccgtcgggcatccatgcctaccgtgaa
tatgattgcacggatctggacgtggcccggcttagtcgtgcattccgtaaagtcgttgca
cggcatgatatgctgagggctcataccctgccggatatgatgcaggtgatcgaacctaaa
gtagatgcggacatcgaaatcattgacctgcgtggcctcgatagatctacacgcgaagct
cggttggtgtccctgcgtgacgccatgtctcaccggatttatgatacggaacgcccgccg
ctgtatcacgttgtggccgttcgcttagatgaacaacagacccgcctggtgctgagcatt
gatctgattaacgttgacctgggcagtctgagcattatctttaaagattggttgagcttt
tacgaagatcctgaaacctcgctgccagtgctggaactgagttaccgcgactacgtcctg
gcgttggaatcgcgtaaaaaatcggaagcccaccagcgctcaatggactactggaaacgc
cgtgttgctgaactcccaccaccgccaatgctgccaatgaaagcggatccgtcgacgttg
cgtgaaattcgcttccgtcataccgaacagtggctcccgtctgatagttggtcgcgttta
aaacaacgtgtaggcgaacggggtctgaccccaacgggtgtaatcctcgcagctttctct
gaggtgatcggccgctggtccgctagcccgcgctttaccctcaacatcactttattcaac
cgtctccctgtgcatccccgggtcaatgatattactggtgattttacaagcatggtgctg
ttggacattgatacgacgcgcgacaaatcattcgaacagcgtgctaaacgcattcaggaa
cagctgtgggaagccatggaccactgcgatgtttctgggattgaagtacagcgcgaagcg
gcacgtgtgctgggcattcaacgcggcgcactgttcccggtagtactgacctcagccctc
aatcaacaggtggttggggttacgtctctgcaacgtctgggcaccccggtttacacgagc
actcagactccgcagctcctgctcgatcatcagctgtacgaacatgacggtgacctggtc
ctggcgtgggatattgtggatggcgtgtttccgccggatctgctggatgatatgttagaa
gcctatgtcgcctttttacgtcgcctgacggaggaaccgtggtctgaacaaatgcgctgc
agcctgccgcccgctcagttagaggcacgtgcatccgccaatgaaactaactcactgctg
tctgaacatactctgcatggtctgtttgccgctcgggtggagcagttaccgatgcagctt
gcagtggttagcgctcgtaaaaccctgacgtatgaggaattgtctcgccgctcccggcgg
ctgggtgcccgcctgcgggaacaaggcgcacgcccgaataccttggtcgccgtcgttatg
gagaaaggttgggaacaagtggttgcggtccttgccgtgctggaaagcggcgcggcttat
gttccgattgatgccgacctgccagcagaacgtattcattacctgcttgatcacggtgag
gttaaattggtgctgactcaaccgtggctggatggcaaacttagctggccgccagggatc
cagcgtctgctggtaagcgacgccggcgtcgaaggggacggcgaccaactgccgatgatg
ccgattcagaccccatcggacttagcatacgtcatctacaccagtggttcgactggtttg
ccgaaaggtgttatgattgatcaccgtggcgctgtcaatacaattttggacatcaacgag
cgctttgagattggtcctggggatcgcgtgctggccctgtcctcactttcttttgatctg
tcggtttatgacgttttcggtatcctcgcggcgggcgggaccattgtggtgccagatgcg
tcaaaactgcgtgacccagcccactgggctgcacttattgaacgcgaaaaagtcactgtg
tggaatagtgtaccggcactgatgcgtatgctggtcgaacactctgaagggcgccctgat
tcgctggcacgtagcctgcgcctcagcctgctgagtggtgattggatccctgtggggctc
ccgggtgaacttcaggctatccgtccgggcgtcagtgttattagcctggggggtgccaca
gaggctagcatctggagcattggctatcctgttcgcaacgtggacccgtcctgggcatca
attccgtatggccgcccgcttcgcaatcagacgttccacgtgcttgacgaggcgctggag
ccacggccggtatgggtgccaggccaactgtatatcggtggcgttggcctggcactgggc
tattggcgtgacgaggaaaaaactcgtaactcttttctcgtccatccggaaacgggggaa
cgcctgtataaaaccggggatctcgggcgctaccttccggatggcaatattgaatttatg
ggccgcgaggataaccaaattaaactgcggggctatcgcgtggaattgggtgaaatcgaa
gaaaccctgaaaagccatcctaacgtgcgcgatgcggtcatcgtgccggttggcaatgat
gccgcaaataaattactgcttgcgtatgtggtaccggagggcacccgccgccgtgcggcg
gaacaggacgcatcacttaagacggaacgtgttgatgcgcgtgcgcatgcagccaaagcg
gacggcctgagcgacggtgagcgcgtccagttcaaactggcacgtcatggcctgcgtcgc
gatctggatggcaaaccggtggtagacctgacgggtctggtaccgcgcgaagcggggctg
gatgtatatgctcgtcgtcgttcggtccgcactttcttagaggcaccgatcccgttcgta
gaatttggtcgctttctgtcttgtcttagctcagtggagcctgatggcgcagctctccct
aaattccgttacccttcggcgggtagtacctacccggtccaaacatacgcctatgcgaaa
agcggccgtatcgagggtgtagacgaaggcttctattactatcatccattcgagcatcgt
ctgctgaaagttagtgatcacggtattgaacgtggcgcgcacgtgccgcagaacttcgac
gtgtttgacgaagctgcctttggtttactctttgttggccgtatcgatgcgatcgagagc
ctgtacgggtcattgagccgcgaattttgtctgttggaagctggttatatggcccaactg
ctcatggagcaagcgccgtcgtgcaacattggggtctgccctgtagggcagtttgatttt
gaacaggtacgcccagttcttgatttacgccattccgatgtttacgtacacggtatgctg
ggcggtcgcgtggatcctcgccagtttcaggtctgtaccctcggccaggattccagccca
cgtcgtgctacgacgcgcggtgccccaccgggtcgcgaccaacattttgctgacatcctt
cgggactttcttcgcactaaactgccggaatatatggtaccgaccgttttcgtcgagttg
gacgcgttaccgctcacttctaacggcaaagtggatcgcaaagcgctgcgggaacgcaaa
gatacatcatccccgcggcactccggtcacaccgccccgcgtgatgctctggaagagatt
ctggtcgccgttgttcgtgaagttctcggtctggaagtggtcgggctgcaacagtctttt
gtagacctgggtgctacttccatccatatcgttcgtatgcgcagcctgttgcagaaacgc
ctggaccgcgaaattgccattacagaacttttccagtacccaaatctgggttcgttagcc
agcggtctttctagtgatagtaaagatttagaacaacgtccgaatatgcaggaccgcgtc
gaggctcgccgcaaaggccggcgtcgttcagggaattgtagctccgtcgacaagcttgcg
gccgcactcgaacaccaccaccaccaccactga
5' End
3' End
NotesNo accession number for the natural gene was mentioned in the paper, so the record AF210843 was used. Also see AF217189.
Expression VectorNAP(BAD)/Myc-HisA (Invitorgen)
Assay MethodsNASDS-PAGE (Coomassie blue staining)
ResultsNot determinedDetectable expression
Protein Functiontype I polyketide synthase
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodE. coli preferred codons were used for the whole gene. Designed by ralph Reid with DNAWorks. To
facilitate cloning, amino acid substitutions were introduced at R1394S; R1385S
Publication Author(s)Mutka SC, Carney JR, Liu Y, Kennedy J.
Corresponding AuthorJonathan Kennedy
Corresponding AddressKosan Biosciences, Inc., 3832 Bay Center Place, Hayward, California 94545.
Publication Year2006
Publication TitleHeterologous Production of Epothilone C and D in Escherichia coli.
AbstractThe epothilones are a family of polyketide natural products that show a high potential as anticancer drugs. They are synthesized by the action of a hybrid nonribosomal peptide synthetase/polyketide synthase in the myxobacterium Sorangium cellulosum. In this work, the genes encoding the entire cluster,epoA, epoB, epoC, epoD, epoE, and epoF, were redesigned and synthesized to allow for expression in Escherichia coli. The expression of the largest of the proteins, EpoD, also required the protein be separated into two polypeptides with compatible module linkers. Using a combination of lowered temperature, chaperone coexpression, and alternative promoters, we succeeded in producing a soluble protein from all genes in the epothilone cluster. The entire synthetic epothilone cluster was then expressed in a strain of E. coli modified to enable polyketide biosynthesis, resulting in the production of epothilones C and D. Furthermore, feeding a thioester of the normal substrate for EpoD to cells expressing the epoD, epoE, and epoF genes also led to the production of epothilones C and D. The design of the synthetic epothilone genes together with E. coli expression provides the ideal platform for both the biochemical investigation of the epothilone PKS and the generation of novel biosynthetic epothilone analogues.
JournalBiochemistry. 2006 Jan 31;45(4):1321-30.. 45(4): 1321-30.
SummaryA cluster of epothilone genes were fully codon-optimized towards E. coli codon preference (with DNAWorks). It appeared that the synthetic epothilone genes were successfully expressed to a detectable level.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=505
PubMed ID16430229
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site