Synthetic Gene DataBase
 

Synthetic Gene 202


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID188202
GenBank Accession
GenBank GI
Gene NamenatSUSYNSU
Gene Length (bp)13321335
SpeciesEquine infectious anemia virus (EIAV)Chlorocebus aethiops
StrainsCOS-1 cells
CDSatggtcagcatcgcattctatggggggatcccagggggaatctcaacccctattacccaa
cagtcagaaaaatctaagtgtgaggagaacacaatgtttcaaccttattgttataataat
gacagtaagaacagcatggcagaatcgaaggaagcaagagaccaagaaatgaacctgaaa
gaagaatctaaagaagaaaaaagaagaaatgactggtggaaaataggtatgtttctgtta
tgcttagcaggaactactggaggaatactttggtggtatgaaggactcccacagcaacat
tatatagggttggtggcgatagggggaagattaaacggatctggccaatcaaatgctata
gaatgctggggttccttcccggggtgtagaccatttcaaaattacttcagttatgagacc
aatagaagcatgcatatggataataatactgctacattattagaagcttatcatagggag
ataacattcatttataagtcttcttgcacagatagtgatcattgtcaagaatatcaatgt
aaaaaagttaatcttaattcctctgactcctctaaccctgtacgtgttgaggatgtaatg
aacacaacggaatattggggatttaaatggctagaatgtaatcaaacagaaaattttaag
actatattagtacctgaaaatgaaatggtaaatatcaatgaacaccaccgagtactgggg
cttcaagtggctggagtgcaaccagaccgagaacttcaagaccatcctggtgcccgagaa
cgagatggtgaacatcaacgtgtacagccaccattttttctggtacaggagaaagggatt
gctaatacttctagaattggcaattgtgggccaacaatatttcttggggttttagaagat
aataagggagtagtacgggggaattatacagcttgcaatgtgagtcgcctaaagataaat
agaaaggattatacagggatctatcaagtacctatattttatacatgtaatttcactaac
ataacttcctgcaataatgagccaataatcagtgttatcatgtatgaaacaaaccaggta
caatatttattgtgtaataataataatagtaataattataattgtgtagtacaaagtttt
ggagttataggacaggcacacttagaactgcctagacctaacaaaagaataaggaaccaa
agctttaaccaatataactgctctataaataacaaaacagaattagaaacatggaagtta
gtaaagacttctggcataactcctttacctatttcttctgaagctaacactggactaatt
agacataagaga
atggtgtccatcgccttctacggcggcatccccggcggcatctccacccccatcacccag
cagtccgagaagtccaagtgcgaggagaacaccatgttccagccctactgctacaacaac
gactccaagaactccatggccgagtccaaggaggcccgcgaccaggagatgaaccttaag
gaggagtccaaggaggagaagcgccgcaacgactggtggaagatcggcatgttcctgctg
tgcctggccggcaccaccggcggcatcctgtggtggtatgagggcctgccccagcagcac
tacatcggcctggtggccatcggcggccgcctgaacggctccggccagtccaacgccatc
gagtgctggggctccttccccggctgccggccattccagaactacttctcctacgagacc
aaccgctccatgcacatggacaacaacaccgccaccctgctggaggcctaccaccgcgag
atcaccttcatctacaagtcctcctgcaccgactccgaccactgccaggagtaccagtgc
aagaaggttaacctgaactcctccgactcctccaaccccgtgcgcgtggaggacgtgatg
aacaccaccgagtactggggcttcaagtggctggagtgcaaccagaccgagaacttcaag
accatcctggtgcccgagaacgagatggtgaacatcaacgacaccgacacctggatcccc
aagggctgcaacgagacctgggcccgcgtgaagcgctgccccattgacatcctttacggc
atccaccccatccgcctgtgcgtgcagccaccattcttcctggtgcaagagaagggcatc
gccaacacctcccgcatcggcaactgcggccccaccatcttcctgggcgtgctggaggac
aacaagggcgtggtgcgcggcaactacaccgcctgcaacgtgtcccgcctgaagatcaac
cgcaaggactacaccggcatctaccaagtgccgatcttctacacctgcaacttcactaac
atcacctcctgcaacaacgagcccatcatctccgtgatcatgtacgagaccaaccaagtg
cagtacctgctgtgcaacaacaacaactccaacaactacaactgcgtggtgcagtccttc
ggcgtgatcggccaggcccacctggagctgccccgccccaacaagcgcatccgcaaccag
tccttcaaccagtacaactgctccatcaacaacaagaccgagcttgagacctggaagctg
gtgaagacctccggcatcacccccctgcccatctcctccgaggccaacaccggcctgatc
cgccacaagcgctga
5' End
3' End
NotesThe CDS of the natural gene provided by the article did not contain a stop codon like the CDS of the recoded gene.
Expression VectorplcnCMVplcnCMV, pCI
Assay MethodsImmunoblot analysis, SDS-PAGEImmunoblot analysis, SDS-PAGE
ResultsLittle significant amountsHigh increase (30 fold higher)
Protein Functionglycoslyated surface protein of virus
Recoding PurposeTo improve expression
Synthesized ByMidland Certified Reagent Company (Midland, TX, US
Recoding MethodImmunoblot analysis, SDS-PAGE
Publication Author(s)Cook, R. F.; Cook, S. J.; Bolin, P. S.; Howe, L. J.; Zhou, W.; Montelaro, R. C.; Issel, C. J.
Corresponding AuthorR. Frank Cook
Corresponding AddressDepartment of Veterinary Science, Gluck Equine Research Center, University of Kentucky, Lexington, KY 40546, USA.
Publication Year2005
Publication TitleGenetic immunization with codon-optimized equine infectious anemia virus (EIAV) surface unit (SU) envelope protein gene sequences stimulates immune responses in ponies
AbstractIn the context of DNA vaccines the native equine infectious anemia virus (EIAV)-envelope gene has proven to be an extremely weak immunogen in horses probably because the RNA transcripts are poorly expressed owing to an unusual codon-usage bias, the possession of multiple RNA splice sites and potential adenosine-rich RNA instability elements. To overcome these problems a synthetic version of sequences encoding the EIAV surface unit (SU) envelope glycoprotein was produced (SYNSU) in which the codon-usage bias was modified to conform to that of highly expressed horse and human genes. In transfected COS-1 cell cultures, the steady state expression levels of SYNSU were at least 30-fold greater than equivalent native SU sequences. More importantly, EIAV-specific humoral and lymphocyte proliferation responses were induced in ponies immunized with a mammalian expression vector encoding SYNSU. However, these immunological responses were unable to confer protection against infection with a virulent EIAV strain.
JournalVet Microbiol. 108(2-Jan): 23-37.
SummaryAfrican Green Monkey (Chlorocebus aethiops) COS-1 cells were transformed with a recoded version of the natSU gene, SYNSU, in order to increase the expression of EIAV (Equine infectious anemia virus) surface unit (SU) envelope protein. The natural gene, natSU was codon optimized based on the codon usage patterns of highly expressed horse and human genes in order to yield SYNSU. SYNSU transformed COS-1 cells produced a much higher amount of protein than the natural gene transformed cells. Overall, the recoding was very successful in its goal to increase expression of SU envelope protein.
CommentsThe data for actual amounts of protein was not provided.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=556
PubMed ID15885929
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site