Synthetic Gene DataBase
 

Synthetic Gene 203


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID189203
GenBank AccessionM59850
GenBank GI158957
Gene NameGL6oGL6
Gene Length (bp)38473847
SpeciesEntamoeba histolyticaCercopithecus aethiops
StrainsHg11COS-7 cells
CDSggccgccttgatgaattttcagcagataatgactattatgacggtggtattatgtctcgt
ggaaagaatgcaggttcatggtatcattcttacactcaccaatatgatgttttctattat
ttagctatgcaaccatggagacattttgtatggactacatgcgataaaaatgataataca
gaatgttataaatatactatcaatgaagatcataatgtaaaggttgaagatattaataaa
acaaatattaaacaagatttttgtcaaaaagaatatgcatatccaattgaaaaatatgaa
gttgattgggacaatgttccagttgatgaacaacgaattgaaagtgtagatattaatgga
aaaacttgttttaaatatgcagctaaaagaccattggcttatgtttatttaaatacaaaa
atgacatatgcaacaaaaactgaagcatatgatgtttgtagaatggatttcattggagga
agatcaattacattcagatcatttaacacagagaataaagcatttattgatcaatataat
acaaacactacatcaaaatgtcttcttaatgtatatgataataatgttaatacacatctt
gcaattatctttggtattactgattctacagtcattaaatcacttcaagagaatttatct
cttttaagtcaactaaaaacagtcaaaggagtaacactctactatcttaaagatgatact
tattttacagttaatattactttagatcaattaaaatatgatacacttgtcaaatacaca
gcaggaacaggacaagttgatccacttattaatattgctaagaatgatttagctactaaa
gttgcagataaaagtaaagataaaaatgcaaatgataaaatcaaaagaggaactatgatt
gtgttaatggatactgcacttggatcagaatttaatgcagaaacagaatttgatagaaag
aatatttcagttcatactgttgttcttaatagaaataaagacccaaagattacacgtagt
gcattgagacttgtttcacttggaccacattatcatgaatttacaggtaatgatgaagtt
aatgcaacaatcactgcacttttcaaaggaattagagccaatttaacagaaagatgtgat
agagataaatgttcaggattttgtgatgcaatgaatagatgcacatgtccaatgtgttgt
gagaatgattgtttctatacatcctgtgatgtagaaacaggatcatgtattccatggcct
aaagctaaaccaaaagcaaagaaagaatgtccagcaacatgtgtaggctcatatgaatgt
agagatcttgaaggatgtgttgttacaaaatataatgacacatgccaaccaaaagtgaaa
tgcatggtaccatattgtgataatgataagaatctaactgaagtatgtaaacaaaaagct
aattgtgaagcagatcaaaaaccaagttctgatggatattgttggagttatacatgtgac
caaactactggtttttgtaagaaagataaacgaggtaaagaaatgtgtacaggaaagaca
aataattgtcaagaatatgtttgtgattcagaacaaagatgtagtgttagagataaagta
tgtgtaaaaacatcaccatacattgaaatgtcatgttatgtagccaagtgtaatctcaat
acaggtatgtgtgagaacagattatcatgtgatacatactcatcatgtggtggagattct
acaggatcagtatgtaaatgtgattctacaactggtaataaatgtcaatgtaataaagta
aaaaatggtaattattgtaattctaaaaaccatgaaatttgtgattatacaggaacaaca
ccacaatgtaaagtgtctaattgtacagaagatcttgttagagatggatgtcttattaag
agatgcaatgaaacaagtaaaacaacatattgggagaatgttgattgttcaaacactaag
attgaatttgctaaagatgataaatctgaaactatgtgtaaacaatattattcaactaca
tgtttgaatggaaaatgtgttgttcaagcagttggtgatgtttctaatgtaggatgtgga
tattgttcaatgggaacagataatattattacatatcatgatgattgtaattcacgtaaa
tcacaatgtggaaactttaatggtaaatgtattaaaggcagtgacaattcttattcttgt
gtatttgaaaaagataaaacttcttctaaatcagataatgatatttgtgctgaatgttct
agtttaacatgtccagctgatactacatacagaacatatacatatgactcaaaaacagga
acatgtaaagcaactgttcaaccaacaccagcatgttcagtatgtgaaagtggtaaattt
gtagagaaatgcaaagatcaaaaattagaacgtaaagtcactttagaaaatggaaaagaa
tataaatacaccattccaaaagattgtgtcaatgaacaatgcattccaagaacatacata
gattgtttaggtaatgatgataactttaaatctatttataacttctatttaccatgtcaa
gcatatgttacagctacctatcattacagttcattattcaatttaactagttataaactt
cacttaccacaaagtgaagaatttatgaaagaggcagacaaagaagcatattgtacatac
gaaataacaacaagagaatgtaaaacatgttcattaattgaaactagagaaaaagtccaa
gaagttgatttgtgtgcagaagaaactaagaatggaggagttccattcaaatgtaagaat
aacaattgcattattgatcctaactttgattgtcaacctattgaatgtaagattcaagag
attgttattacagaaaaagatggaataaaaacaacaacatgtaaaaatactacaaaagca
acatgtgacactaacaataagagaatagaagatgcacgtaaagcattcattgaaggaaaa
gaaggaattgagcaagtagaatgtgcaagtactgtttgtcaaaatgataatagttgtcca
attattactgatgtagaaaaatgtaatcaaaacacagaagtagattatggatgtaaagca
atgacaggagaatgtgatggtactacatatctttgtaaatttgtacaacttactgatgat
ccatcattagatagtgaacattttagaactaaatcaggagttgaacttaacaatgcatgt
ttgaaatataaatgtgttgagagtaaaggaagtgatggaaaaatcacacataaatgggaa
attgatacagaacgatcaaatgctaatccaaaaccaagaaatccatgcgaaaccgcaaca
tgtaatcaaacaactggagaaactatttacacaaagaaaacatgtactgtttcagaattc
ccaacaatcacaccaaatcaaggaagatgtttctattgtcaatgttcatatcttgacggt
tcatcagttcttactatgtatggagaaacagataaagaatattatgatcttgatgcatgt
ggtaattgtcgtgtttggaatcagacagatagaacacaacaacttaataatcacaccgag
tgtattctcgcaggagaaattaataatgttggagctattgcagcggcaactactgtggct
gctgttatagttgcagttgtagttgcattaattgttgtttctattggattatttaagact
tatcaacttgtttcatcagctatgaagaatgccattacaataactaatgaaaatgcagaa
tatgttggagcagataatgaagcaactaatgcagcaacattcaatggataagaacaataa
ttaagcc
ggccgccttgatgaattttcagcagataatgactattatgacggtggtattatgtctcgt
ggaaagaatgcaggttcatggtatcattcttacactcaccaatatgatgttttctattat
ttagctatgcaaccatggagacattttgtatggactacatgcgataaaaatgataataca
gaatgttataaatatactatcaatgaagatcataatgtaaaggttgaagatattaataaa
acaaatattaaacaagatttttgtcaaaaagaatatgcatatccaattgaaaaatatgaa
gttgattgggacaatgttccagttgatgaacaacgaattgaaagtgtagatattaatgga
aaaacttgttttaaatatgcagctaaaagaccattggcttatgtttatttaaatacaaaa
atgacatatgcaacaaaaactgaagcatatgatgtttgtagaatggatttcattggagga
agatcaattacattcagatcatttaacacagagaataaagcatttattgatcaatataat
acaaacactacatcaaaatgtcttcttaatgtatatgataataatgttaatacacatctt
gcaattatctttggtattactgattctacagtcattaaatcacttcaagagaatttatct
cttttaagtcaactaaaaacagtcaaaggagtaacactctactatcttaaagatgatact
tattttacagttaatattactttagatcaattaaaatatgatacacttgtcaaatacaca
gcaggaacaggacaagttgatccacttattaatattgctaagaatgatttagctactaaa
gttgcagataaaagtaaagataaaaatgcaaatgataaaatcaaaagaggaactatgatt
gtgttaatggatactgcacttggatcagaatttaatgcagaaacagaatttgatagaaag
aatatttcagttcatactgttgttcttaatagaaataaagacccaaagattacacgtagt
gcattgagacttgtttcacttggaccacattatcatgaatttacaggtaatgatgaagtt
aatgcaacaatcactgcacttttcaaaggaattagagccaatttaacagaaagatgtgat
agagataaatgttcaggattttgtgatgcaatgaatagatgcacatgtccaatgtgttgt
gagaatgattgtttctatacatcctgtgatgtagaaacaggatcatgtattccatggcct
aaagctaaaccaaaagcaaagaaagaatgtccagcaacatgtgtaggctcatatgaatgt
agagatcttgaaggatgtgttgttacaaaatataatgacacatgccaaccaaaagtgaaa
tgcatggtaccatattgtgataatgataagaatctaactgaagtatgtaaacaaaaagct
aattgtgaagcagatcaaaaaccaagttctgatggatattgttggagttatacatgtgac
caaactactggtttttgtaagaaagataaacgaggtaaagaaatgtgtacaggaaagaca
aataattgtcaagaatatgtttgtgattcagaacaaagatgtagtgttagagataaagta
tgtgtaaaaacatcaccatacattgaaatgtcatgttatgtagccaagtgtaatctcaat
acaggtatgtgtgagaacagattatcatgtgatacatactcatcatgtggtggagattct
acaggatcagtatgtaaatgtgattctacaactggtaataaatgtcaatgtaataaagta
aaaaatggtaattattgtaattctaaaaaccatgaaatttgtgattatacaggaacaaca
ccacaatgtaaagtgtctaattgtacagaagatcttgttagagatggatgtcttattaag
agatgcaatgaaacaagtaaaacaacatattgggagaatgttgattgttcaaacactaag
attgaatttgctaaagatgataaatctgaaactatgtgtaaacaatattattcaactaca
tgtttgaatggaaaatgtgttgttcaagcagttggtgatgtttctaatgtaggatgtgga
tattgttcaatgggaacagataatattattacatatcatgatgattgtaattcacgtaaa
tcacaatgtggaaactttaatggtaaatgtattaaaggcagtgacaattcttattcttgt
gtatttgaaaaagataaaacttcttctaaatcagataatgatatttgtgctgaatgttct
agtttaacatgtccagctgatactacatacagaacatatacatatgactcaaaaacagga
acatgtaaagcaactgttcaaccaacaccagcatgttcagtatgtgaaagtggtaaattt
gtagagaaatgcaaagatcaaaaattagaacgtaaagtcactttagaaaatggaaaagaa
tataaatacaccattccaaaagattgtgtcaatgaacaatgcattccaagaacatacata
gattgtttaggtaatgatgataactttaaatctatttataacttctatttaccatgtcaa
gcatatgttacagctacctatcattacagttcattattcaatttaactagttataaactt
cacttaccacaaagtgaagaatttatgaaagaggcagacaaagaggcctactgcacctac
gagatcaccaccagagagtgcaagacctgcagcctgatcgagaccagagagaaggtgcag
gaggtggacctgtgcgctgaggagaccaagaacggcggcgtgcccttcaagtgcaagaac
aacaactgcatcatcgatcccaacttcgactgccagcccatcgagtgcaagatccaggag
atcgtgatcaccgagaaggacggcatcaagaccaccacctgcaagaacaccaccaaggct
acctgcgacaccaacaacaagagaatcgaggacgctagaaaagctttcatcgagggcaag
gagggcatcgagcaggtggagtgcgctagcaccgtgtgccagaacgacaacagctgcccc
atcatcaccgacgtggagaagtgcaaccagaacaccgaggtcgactacggctgcaaggct
atgaccggcgagtgcgacggcaccacctacctgtgcaagttcgtgcagctgaccgacgac
cccagcctggacagcgagcacttcagaaccaagagcggcgtggagctgaacaacgcttgc
ctgaagtataaatgtgttgagagtaaaggaagtgatggaaaaatcacacataaatgggaa
attgatacagaacgatcaaatgctaatccaaaaccaagaaatccatgcgaaaccgcaaca
tgtaatcaaacaactggagaaactatttacacaaagaaaacatgtactgtttcagaattc
ccaacaatcacaccaaatcaaggaagatgtttctattgtcaatgttcatatcttgacggt
tcatcagttcttactatgtatggagaaacagataaagaatattatgatcttgatgcatgt
ggtaattgtcgtgtttggaatcagacagatagaacacaacaacttaataatcacaccgag
tgtattctcgcaggagaaattaataatgttggagctattgcagcggcaactactgtggct
gctgttatagttgcagttgtagttgcattaattgttgtttctattggattatttaagact
tatcaacttgtttcatcagctatgaagaatgccattacaataactaatgaaaatgcagaa
tatgttggagcagataatgaagcaactaatgcagcaacattcaatggataagaacaataa
ttaagcc
5' End
3' End
NotesNo tests were done with the natural gene because the natural gene could not be correctly placed into the expression vector.The Hg11 protein was codon modified only from amino acid residues Though there was quantitative analysis for the amount of protein, the authors suggest that the recoded gene would’ve been expressed more than the natural gene.
Expression VectorpCIST
Assay MethodsImmunoblot analysis
ResultsSignificant amounts (Based on the amount of spleen and mononuclear cells due to immune response)
Protein FunctionAllows adhesion to colonicmucin for colonization and target cells.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodGL6 was codon optimized based on the synonymous codon usage patterns of gerbils (Meriones
unguiculatus). Including an optimal stop codon and TGAG sequence for termination.
Publication Author(s)Gaucher, D.; Chadee, K.
Corresponding AuthorKris Chadee
Corresponding AddressInstitute of Parasitology of McGill University, Macdonald Campus, 21,111 Lakeshore Road, Ste. Anne de Bellevue, Que., Canada H9X 3V9.
Publication Year2002
Publication TitleConstruction and immunogenicity of a codon-optimized Entamoeba histolytica Gal-lectin-based DNA vaccine
AbstractInvasive amebiasis caused by Entamoeba histolytica is the third leading parasitic cause of mortality, and there are no vaccines available to help control the disease. The galactose-adherence lectin (Gal-lectin) is the parasite's major molecule allowing it to adhere to colonic mucin for colonization and to target cells for tissue destruction. It is immunodominant and is regarded as the most promising candidate molecule to be included in a subunit vaccine against amebiasis. In this study, we are reporting the construction of a codon-optimized DNA vaccine encoding a portion of the Gal-lectin heavy subunit that includes the carbohydrate recognition domain (CRD), and its in vivo testing in mice. The vaccine stimulated a Th1-type Gal-lectin-specific cellular immune response as well as the development of serum antibodies that recognized a recombinant portion of the heavy subunit, and that inhibited the adherence of trophozoites to target cells in vitro.
JournalVaccine. 20(27-28): 3244-53.
SummaryCercopithecus aethiops (African Green Monkey) COS-7 cells were transformed with a recoded version of the GL6 gene, oGL6, in an attempt to increase expression of the Gal-lectin heavy subunit. The natural gene was codon optimized based on the synonymous codon usage patterns of gerbils (Meriones unguiculatus). The recoded gene, oGL6 produced a significant amount of protein based on the immunological response from the COS-7 cells. Since the natural gene could not even be inserted into a vector, and the recoded gene was able to produce protein, the recoding can be considered successful in its attempt to increase protein expression.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=545
PubMed ID12213393
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site