Synthetic Gene DataBase
 

Synthetic Gene 204


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID76204
GenBank AccessionBC085758
GenBank GI55716052
Gene NameFntaFnta-Opt
Gene Length (bp)2641133
SpeciesRattus norvegicusEscherichia coli
StrainsBL21(DE3)
CDSatggcggccactgagggggtcggggaatctgcgccaggcggtgagccgggacagccagag
cagccgccgcccccgcctcctccgccgccagcacagcagccgcaggaagaagagatggcg
gccgaggccggggaagcagcggcgtcccctatggacgacgggtttctgagcctggactcg
cccacctatgtcttgtacagggacagggcagagtgggctgacatagacccagtgccccag
aatgatggccccagtccagtggtc
atggctgctactgaaggtgttggtgaatctgcgccaggcggtgagccgggtcagccggag
cagccgccgccgccgccgccgccgccgccggccagcagccgcaggaagaagagatggcgg
ctgaggctggtgaagcagctgcttccccgatggacgacggtttcctgtctctggactccc
cgacctacgttctgtaccgtgaccgtgcagagtgggctgacatcgacccggtgccgcaga
acgacggccccagtccagtggtccagatcatctacagtgaaaagtttagagacgtctatg
attacttccgagctgttctgcagcgcgatgaaagaagcgaacgagcctttaagctcactc
gagatgctattgagttaaacgcagccaactatacggtgtggcattttcggagagttctct
tgaggtcgcttcagaaggatctgcaagaagaaatgaactacatcactgcaataattgagg
aacagcccaaaaactatcaagtttggcaccataggagagtattagtggagtggctgaaag
atccttctcaagagctcgagttcatcgccgatatccttaatcaggatgcaaagaattacc
atgcctggcagcatcgacagtgggtcattcaggagtttcgactttgggataatgagctgc
agtatgtggaccagcttctcaaagaggatgtgagaaataactctgtgtggaaccaaagac
acttcgtcatttctaataccactggctacagtgatcgcgctgtgttggagagagaagtcc
aatatactctggaaatgatcaaattagtgccacacaatgagagtgcgtggaactacttga
aagggattttgcaggaccgtggtctttccagataccctaatctattaaaccagttgcttg
atttacaaccaagtcacagctccccctacctaattgcctttcttgtggatatctatgaag
acatgctggaaaaccagtgtgacaacaaggaggacattcttaataaagcactagagttat
gtgagattctagctaaagaaaaggacactataagaaaggaatattggagatatattggac
ggtccctccagagtaaacacagcagagaaagtgacataccggcgagtgtatag
5' End
3' End
Notes
Expression VectorFPT/pET 23apET23a
Assay MethodsFilter bindingSDS-PAGE
ResultsThe wild type gene was expressed poorly, due to a set of rare codons at the beginning of the alpha subunit, causing transcription initialization to be hindered.The recoded gene was expressed to produce approximately 6% of the total cell protein.
Protein FunctionCatalyzed 15-carbon moiety to C-terminal cysteine
Recoding PurposeTo improve expression
Synthesized By
Recoding MethodThe recoding method was not explained in this paper.
Publication Author(s)Zimmerman, K. K.; Scholten, J. D.; Huang, C. C.; Fierke, C. A.; Hupe, D. J.
Corresponding AuthorCarol A. Fierke
Corresponding AddressParke-Davis Pharmaceutical Research, Division of Warner-Lambert Company, 2800 Plymouth Road, Ann Arbor, Michigan, 48105, USA.
Publication Year1998
Publication TitleHigh-level expression of rat farnesyl:protein transferase in Escherichia coli as a translationally coupled heterodimer
AbstractFarnesyl:protein transferase (FPTase) catalyzes the transfer of a 15-carbon farnesyl isoprenoid group from farnesyl diphosphate to the CaaX cysteine of a variety of cellular proteins. Since FPTase is a large (95-kDa) heterodimeric protein and is inactive unless the alpha- and beta-subunits are coexpressed, large-scale overexpression of active enzyme has been challenging. We report the design of a translationally coupled expression system that will produce FPTase at levels as high as 30 mg/L Escherichia coli. Heterodimeric expression of FPTase was achieved using a translationally coupled operon from the T7 promoter of the pET23a (Novagen) expression plasmid. The beta-subunit-coding sequence was placed upstream of the alpha-subunit coding sequence linked by overlapping beta-subunit stop and alpha-subunit start codons. Additionally, the initial 88 codons of the alpha-subunit gene were altered, removing rare codons and replacing them with codons used in highly expressed proteins in E. coli. Since previous attempts at recombinantly expressing FPTase in E. coli from a translationally coupled system have demonstrated that initiation of translation of the alpha-subunit is poor, we propose that the optimization of the codons at the start of the alpha-subunit gene leads to the observed high level of recombinant expression.
JournalProtein Expr Purif. 14(3): 395-402.
SummaryThe goal of this experiment was to optimize the FPTase gene for expression in E. coli so that it can be synthesized in greater amounts. The first 88 codons in the alpha subunit of the wild type gene for FPTase was optimized and cloned into plasmid pET 23a along with the natural gene for the beta subunit. This resulted in a much higher rate of synthesis of the enzyme.
CommentsThe method of recoding was not explained in the paper, and the recoded gene was not entered into GenBank.
Discussion
PubMed ID9882574
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site