Synthetic Gene DataBase
 

Synthetic Gene 208


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID192208
GenBank AccessionZ14147AF398463
GenBank GI4930531295617
Gene NameCyt2Aa1syncyt2Aa1
Gene Length (bp)780681
SpeciesBacillus thuringiensisPichia pastoris
StrainskyushuensisKM71
CDSatgtatactaaaaattttagtaattccagaatggaagtaaaaggtaataacgggtgttct
gcacctattattagaaaaccatttaaacatattgtattaacggttccatccagtgattta
gataattttaatacagtcttttatgtacaaccacaatacattaatcaggctcttcattta
gcaaatgcttttcaaggggctatagacccacttaatttaaatttcaattttgaaaaggca
ctccaaattgcaaatggtattcctaattctgcaattgtaaaaactcttaatcaaagtgtt
atacagcaaacagttgaaatttcagttatggttgagcaacttaaaaagattattcaagag
gttttaggacttgttattaacagtactagtttttggaattcggtagaagctacaattaaa
ggcacatttacaaatttagacactcaaatagatgaagcatggattttttggcatagttta
tccgcccataatacaagttattattataatattttattttctattcaaaatgaagataca
ggtgcagttatggcagtattacctttagcatttgaggtttctgtggatgttgaaaaacaa
aaagtattattctttacaataaaagatagtgcacgatatgaagttaaaatgaaagctttg
actttagttcaagctctacattcctctaatgccccaattgtagatatatttaatgttaat
aactataatttataccattctaatcataagattattcaaaatttaaatttatcgaattga
atgtctccgcggtccgacctggacaacttcaacaccgtcttctacgtccaaccacagtac
atcaaccaggctttgcacttggctaacgctttccagggtgctatcgacccattgaacttg
aacttcaacttcgagaaggctttgcagatcgctaacggtatcccaaactccgctatcgtc
aagaccttgaaccagtccgtcatccagcagaccgtcgagatttccgtcatggtcgagcag
ttgaagaagatcatccaagaggtcttgggtttggtcatcaactccacctccttctggaac
tccgtcgaggctaccatcaagggtactttcaccaacttggacactcagatcgacgaggct
tggatcttctggcactccttgtccgctcacaacacctcctactactacaacatcttgttc
tccatccagaacgaggacactggtgctgtcatggctgtcttgccattggctttcgaggtc
tccgtcgacgtcgagaagcagaaggtcttgttcttcaccatcaaggactccgctagatac
gaggtcaagatgaaggctttgaccttggtccaggctttgcactcctccaacgctccaatc
gtcgacatctttctagaacaaaaactcatctcagaagaggatctgaatagcgccgtcgac
catcatcatcatcatcattga
5' End
3' End
NotesThought there were no natural tests in this study. The initial tests did not proceed due to premature transcription termination.
Expression VectorpPICZ-alpha-A, pPICZB
Assay MethodsSDS-PAGE, immunoblot analysis (rabbit polyclonal anti-cyt2Aa1, mouse monoclonal antiMyc, anti-hexahistidine antibody)
ResultsSignificant amount (intracellularly, average of 1mg/L, up to 10mg/L)
Protein FunctionInsecticide and possible development of anti-tumor immunotoxins.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe natural gene was codon optimized for heterologous expression in P. pastoris and a Kozak
consensus sequence was added to the sequence.
Publication Author(s)Gurkan, C.; Ellar, D. J.
Corresponding AuthorCemal Gurkan
Corresponding AddressDepartment of Biochemistry, University of Cambridge, 80 Tennis Court Road, Cambridge CB2 1GA, UK. cemalgurkan@cal.berkeley.edu
Publication Year2003
Publication TitleExpression of the Bacillus thuringiensis Cyt2Aa1 toxin in Pichia pastoris using a synthetic gene construct
AbstractThe nucleotide sequence data corresponding to the syncyt2Aa1 open reading frame was deposited with the EMBL/GenBank Nucleotide Sequence Databases under the accession number AF398463. Bacillus thuringiensis delta-endotoxins are membrane-active, pore-forming proteins with highly specific insecticidal activities. In addition to a well-established role in the biological control of a wide variety of crop pests and disease vectors, these toxins also have great potential for the development of anti-tumour agents called immunotoxins (ITs), chimaeric molecules consisting of a cell-binding ligand coupled to a toxin or its subunits. The ultimate goal of our study was the recombinant production of such ITs based on the Cyt2Aa1 toxin from B. thuringiensis subspecies kyushuensis. We explored the use of Pichia pastoris for recombinant IT production because earlier attempts in our laboratory using the Escherichia coli expression system or various chemical conjugation strategies yielded only low levels of functional product. However, our initial attempts were not successful because the A+T-rich bacterial cyt2Aa1 gene contained fortuitous polyadenylation sites, causing premature transcription termination in this yeast. Accordingly, we designed and constructed a synthetic cyt2Aa1 gene (syncyt2Aa1) optimized for heterologous expression in P. pastoris. This was achieved by increasing the overall G+C content of the bacterial cyt2Aa1 while changing its codon usage to that preferred by the methylotrophic yeast. Here we describe in detail the design, synthesis and requisite PCR repair of syncyt2Aa1, then present analyses of recombinant Cyt2Aa1 expression in P. pastoris using this synthetic gene. Following the results presented in this paper, the syncyt2Aa1 gene was also successfully used for the recombinant production of a Cyt2Aa1-based IT in the same expression host.
JournalBiotechnol Appl Biochem. 38(Pt 1): 25-33.
SummaryA methylotrophic yeast (Pichia pastoris) was transformed with a recoded version of the natural gene Cyt2Aa1, syncyt2Aa1, in order to increase the expression of the Cyt2Aa1 endotoxin in the yeast. Cyt2Aa1was codon optimized based on the codon usage patterns of P. pastoris. syncyt2Aa1 produced a significant amount of protein whereas the natural gene, in previous tests, was not able to. The recoding can be considered successful since it was able to accomplish its goal in increasing expression of the protein in P. pastoris.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=554
PubMed ID12628007
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site