Synthetic Gene DataBase
 

Synthetic Gene 209


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID193209
GenBank AccessionAF044078
GenBank GI2852389
Gene Namelip1slip1
Gene Length (bp)01688
SpeciesCandida rugosaPichia pastoris, Saccharomyces cerevisiae
StrainsGS115 (P. pastoris), Invsc2 cells (S. cerevisiae)
CDSatggaattggctttggctttgtctttgattgcctccgttgctgctgccccaaccgccact
ttggctaacggtgacaccatcaccggtttgaacgccatcatcaacgaagccttcttgggt
attccatttgccgaaccaccagttggtaacttgagattcaaggacccagttccatactcc
ggttccttggatggtcaaaagttcacttcttacggtccatcttgtatgcaacaaaaccca
gaaggtacctacgaagaaaacttgccaaaggcagctttagatctggttatgcaatccaaa
gttttcgaagctgtttctccatcttctgaagactgtttgaccattaatgttgttagacca
cccgggacaaaggctggtgccaacttgccagttatgttgtggatctttggtggtggtttt
gaagttggtggtactagtaccttccctccagcccaaatgattaccaagtctattgctatg
ggtaagccaatcatccacgtttctgtcaactacagagtctcgagctggggtttcttggct
ggtgacgaaatcaaggccgaaggttctgccaacgccggtttgaaggaccaaagattgggt
atgcaatgggtggctgacaacattgctgcttttggtggtgatccaactaaggttactatc
tttggtgaatctgctggttctatgtccgtcatgtgtcacattttgtggaacgacggtgac
aacacttacaagggtaagccattgttcagagctggtatcatgcaatctggtgctatggtt
ccatctgacgccgtcgacggtatctacggtaacgaaatttttgacttgttggcttccaac
gctggttgtggttctgcctctgacaagttggcttgtttgagaggtgtttcttctgacact
ttggaagacgccaccaacaacacccctggtttcttggcttactcctccttaagattgtct
tacttgccaagaccagacggtgttaacatcaccgacgacatgtacgctttggttagagaa
ggtaagtatgccaacatccctgttatcatcggtgaccaaaacgacgaaggtaccttcttt
ggtacttcttctttgaacgttaccactgatgcccaagccagagaatatttcaagcaatct
tttgtccacgctagcgacgctgaaatcgacactttgatgactgcttacccaggtgacatc
actcaaggttctccatttgacactggaattctaaacgccttgaccccacaattcaagaga
atctctgctgttttgggtgacttgggttttactttggctcgtagatacttcttgaaccac
tacaccggtggtaccaagtactctttcttgtctaagcaattgtctggtttgccagttttg
ggtactttccactccaacgatatcgtcttccaagactacttgttgggttctggttccttg
atctacaacaacgctttcattgcttttgccactgacttggacccaaacaccgccggtttg
ttggttaagtggccagaatacacctcttcttctcaatctggtaacaacttgatgatgatc
aacgctttgggtttgtacaccggtaaggacaacttcagaaccgccggttacgacgctttg
ttctccaacccaccatctttctttgtttga
5' End
3' End
NotesThe natural gene was only transformed in S. cerevisiae.There were 3 constructs, each with 3 different leader sequences; Alpha-factor prepro-signal peptide (pp-slip1), the natural leader sequence (nl-slip1), and alpha-factor pre-signal sequence (p-slip1). The yield in P. pastoris was 2 fold more than the production of the natural gene in C. rugosa.
Expression VectorpEMBLyex4pPICZ-alpha-B (P. pastoris), pYES2 (S. cerevisiae)
Assay MethodsSDS-PAGE, Western BlotSDS-PAGE, Western Blot
ResultsNo expressionHigh increase (Post 5 days: 85U/mL for pp-slip1 and p-slip1, 3U/mL for nl-slip1 12-17 fold higher in P. pastoris; in S. cerevisiae 5-7 U/mL in all transformants)
Protein Function
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe natural gene was codon optimized based on the codon usage of highly expressed genes in
Saccharomyces cerevisiae.
Publication Author(s)Brocca, S.; Schmidt-Dannert, C.; Lotti, M.; Alberghina, L.; Schmid, R. D.
Corresponding AuthorRolf D. Schmid
Corresponding AddressInstitut fur Technische Biochemie, Universitat Stuttgart, Germany.
Publication Year1998
Publication TitleDesign, total synthesis, and functional overexpression of the Candida rugosa lip1 gene coding for a major industrial lipase
AbstractThe dimorphic yeast Candida rugosa has an unusual codon usage that hampers the functional expression of genes derived from this yeast in a conventional heterologous host. Commercial samples of C. rugosa lipase (CRL) are widely used in industry, but contain several different isoforms encoded by the lip gene family, among which the isoform encoded by the gene lip1 is the most prominent. In a first laborious attempt, the lip1 gene was systematically modified by site-directed mutagenesis to gain functional expression in Saccharomyces cerevisiae. As alternative approach, the gene (1647 bp) was completely synthesized with an optimized nucleotide sequence in terms of heterologous expression in yeast and simplified genetic manipulation. The synthetic gene was functionally expressed in both hosts S. cerevisiae and Pichia pastoris, and the effect of heterologous leader sequences on expression and secretion was investigated. In particular, using P. pastoris cells, the synthetic gene was functionally overexpressed, allowing for the first time to produce recombinant Lipl of high purity at a level of 150 U/mL culture medium. The physicochemical and catalytic properties of the recombinant lipase were compared with those of a commercial, nonrecombinant C. rugosa lipase preparation containing lipase isoforms.
JournalProtein Sci. 7(6): 1415-22.
SummaryPichia pastoris and Saccharomyces cerevisiae were transformed with a recoded version of the natural lip1 gene, slip1, in order to increase the expression of triacylglycerol lipase protein (Lip1). To attain slip1, the natural gene, lip1, was codon optimized based on the codon usage patterns of highly expressed genes in S. cerevisiae. lip1 was not expressed in S. cerevisiae (only S. cerevisiae was transformed by the natural gene), whereas slip1 had a significant yield. In P. pastoris, slip1 had a much higher yield, more than the natural gene or S. cerevisiae transformants. Overall, the recoding was very successful since the protein expression was greatly increased from the natural gene.
CommentsThe corresponding author was contacted for the CDS of the natural gene on 1/18/2006, but no reply was received.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=552
PubMed ID9655346
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site