Synthetic Gene DataBase
 

Synthetic Gene 213


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID195213
GenBank AccessionU65407AF512508
GenBank GI157553125271704
Gene NameAMA1 (3D7)PpAMA1 (3D7)
Gene Length (bp)18691599
SpeciesPlasmodium falciparum (malaria)Pichia pastoris
Strains3D7GS114 (his4)
CDSatgagaaaattatactgcgtattattattgagcgcctttgagtttacatatatgataaac
tttggaagaggacagaattattgggaacatccatatcaaaatagtgatgtgtatcgtcca
atcaacgaacatagggaacatccaaaagaatacgaatatccattacaccaggaacataca
taccaacaagaagattcaggagaagacgaaaatacattacaacacgcatatccaatagac
cacgaaggtgccgaacccgcaccacaagaacaaaatttattttcaagcattgaaatagta
gaaagaagtaattatatgggtaatccatggacggaatatatggcaaaatatgatattgaa
gaagttcatggttcaggtataagagtagatttaggagaagatgctgaagtagctggaact
caatatagacttccatcagggaaatgtccagtatttggtaaaggtataattattgagaat
tcaaatactacttttttaacaccggtagctacgggaaatcaatatttaaaagatggaggt
tttgcttttcctccaacagaacctcttatgtcaccaatgacattagatgaaatgagacat
ttttataaagataataaatatgtaaaaaatttagatgaattgactttatgttcaagacat
gcaggaaatatgattccagataatgataaaaattcaaattataaatatccagctgtttat
gatgacaaagataaaaagtgtcatatattatatattgcagctcaagaaaataatggtcct
agatattgtaataaagacgaaagtaaaagaaacagcatgttttgttttagaccagcaaaa
gatatatcatttcaaaactatacatatttaagtaagaatgtagttgataactgggaaaaa
gtttgccctagaaagaatttacagaatgcaaaattcggattatgggtcgatggaaattgt
gaagatataccacatgtaaatgaatttccagcaattgatctttttgaatgtaataaatta
gtttttgaattgagtgcttcggatcaacctaaacaatatgaacaacatttaacagattat
gaaaaaattaaagaaggtttcaaaaataagaacgctagtatgatcaaaagtgcttttctt
cccactggtgcttttaaagcagatagatataaaagtcatggtaagggttataattgggga
aattataacacagaaacacaaaaatgtgaaatttttaatgtcaaaccaacatgtttaatt
aacaattcatcatacattgctactactgctttgtcccatcccatcgaagttgaaaacaat
tttccatgttcattatataaagatgaaataatgaaagaaatcgaaagagaatcaaaacga
attaaattaaatgataatgatgatgaagggaataaaaaaattatagctccaagaattttt
atttcagatgataaagacagtttaaaatgcccatgtgaccctgaaatggtaagtaatagt
acatgtcgtttctttgtatgtaaatgtgtagaaagaagggcagaagtaacatcaaataat
gaagttgtagttaaagaagaatataaagatgaatatgcagatattcctgaacataaacca
acttatgataaaatgaaaattataattgcatcatcagctgctgtcgctgtattagcaact
attttaatggtttatctttataaaagaaaaggaaatgctgaaaaatatgataaaatggat
gaaccacaagattatgggaaatcaaattcaagaaatgatgaaatgttagatcctgaggca
tctttttggggggaagaaaaaagagcatcacatacaacaccagttctgatggaaaaacca
tactattaa
tacgtacagaactactgggaacatccataccaaaactctgatgtgtacaggccaataaat
gaacatcgtgaacatccaaaggaatatgaatacccattgcaccaggaacatacttatcaa
caagaagattccggggaagacgaaaacactttgcaacacgcatacccaattgaccacgaa
ggagctgaacccgcaccacaagaacaaaacttgttttccagcatcgaaattgtcgaaaga
tctaactacatgggaaacccatggacggaatacatggcaaagtacgatatcgaagaagtt
catggttccggaattagagtcgatttgggggaagatgcggaagtcgcggggacacaatac
agacttccatccggtaagtgtccagtctttggaaagggaattatcatcgagaactccaag
acaacatttttgactccggtcgcgacggggaaccaatacttgaaggatgggggatttgcg
tttcctccaactgaacctctgatgtccccaatgactttggatgaaatgagacatttttac
aaggataacaagtacgtcaagaacttggatgaactgacattgtgttccagacatgcaggg
aacatgatcccagataacgataagaactccaactacaagtacccagcggtttacgatgac
aaggataagaaatgtcatattttgtacatcgcagcgcaagaaaacaacggacctagatac
tgtaacaaggacgaatctaagagaaatagcatgttttgttttagaccagcaaaggatatt
tcctttcaaaatttggtctacttgtctaaaaacgtcgttgataattgggaaaaggtttgc
cctagaaagaacttgcagaacgcaaagttcgggttgtgggtagatgggaactgtgaagat
attccacatgtcaacgaatttccagcaatcgatctttttgaatgtaacaagttggttttt
gaactgtctgcgtcggatcaacctaagcaatacgaacaacatttgactgattacgaaaag
atcaaggaaggattcaagaacaaaaatagagaaatgataaagtctgcgtttcttcccaca
ggagcgtttaaggcagatagatacaagtctcatggaaaaggatacaactgggggaactac
aatactgaaactcaaaagtgtgaaatctttaacgtaaagccaacttgtttgatcaatgac
aagaactatatcgcgacaacagcgctgagtcatcccatagaagttgaaaataactttcca
tgttccttgtacaaggatgaaattatgaaggaaatagaaagagaatccaagcgaatcaag
ttgaacgataacgatgatgaaggtaacaagaagatcattgcgccaagaatctttatctcc
gatgataaggactctttgaagtgcccatgtgaccctgaaatggtctctcaatctacttgt
aggttctttgtctgtaagtgtgtcgaaagacgtgcagaagtcacttccaacaacgaagtt
gtcgttaaggaagaatacaaggatgaatacgcagatatccctgaacataagccaacatac
gataagatgaagactagtcaccatcaccatcaccactaa
5' End
3' End
NotesOnly the AA25 to AA546 were used in synthetic gene. The synthetic gene contains YV at the N-terminus and TSHHHHHH at the C-terminus.
Expression VectorNApPIC9K
Assay MethodsNASDS-PAGE, Western blot,
ResultsNot determinedProduction of final AMA1 protein is 28.3 mg/liter.
Protein FunctionHelp invasion (apical membrane antigen)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe synthetic DNA sequences were designed using a computer algorithm that matched each codon used by
P. falciparum with a codon used with the same frequency for that amino acid by P. pastoris.
Publication Author(s)Kennedy MC, Wang J, Zhang Y, Miles AP, Chitsaz F, Saul A, Long CA, Miller LH, Stowers AW.
Corresponding AuthorAnthony W. Stowers
Corresponding AddressMalaria Vaccine Development Unit, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, Maryland 20852, USA.
Publication Year2002
Publication TitleIn vitro studies with recombinant Plasmodium falciparum apical membrane antigen 1 (AMA1): production and activity of an AMA1 vaccine and generation of a multiallelic response.
AbstractApical membrane antigen 1 (AMA1) is regarded as a leading malaria blood-stage vaccine candidate. While the overall structure of AMA1 is conserved in Plasmodium spp., numerous AMA1 allelic variants of P. falciparum have been described. The effect of AMA1 allelic diversity on the ability of a recombinant AMA1 vaccine to protect against human infection by different P. falciparum strains is unknown. We characterize two allelic forms of AMA1 that were both produced in Pichia pastoris at a sufficient economy of scale to be usable for clinical vaccine studies. Both proteins were used to immunize rabbits, singly and in combination, in order to evaluate their immunogenicity and the ability of elicited antibodies to block the growth of different P. falciparum clones. Both antigens, when used alone, elicited high homologous anti-AMA1 titers, with reduced strain cross-reactivity. Similarly, sera from rabbits immunized with a single antigen were capable of blocking the growth of homologous parasite strains at levels theoretically sufficient to clear parasite infections. However, heterologous inhibition was significantly reduced, providing experimental evidence that AMA1 allelic diversity is a result of immune pressure. Encouragingly, rabbits immunized with a combination of both antigens exhibited titers and levels of parasite inhibition as good as those of the single-antigen-immunized rabbits for each of the homologous parasite lines, and consequently exhibited a broadening of allelic diversity coverage.
JournalInfect Immun.. 70(12): 6948-60.
SummaryTo achieve high production of AMA1 protein, a profile matching algorithm was used to modify the native AMA1 gene with the reference to P. pastoris codon preference. it appeared that synthetic AMA1 genes were expressed successfully in P. pastoris.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=502
PubMed ID12438374
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site