Synthetic Gene DataBase
 

Synthetic Gene 214


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID196214
GenBank AccessionL32018
GenBank GI529229
Gene NameUL26syntheticUL26
Gene Length (bp)774774
SpeciesHerpes simplex virus 1Escherichia coli
Strains
CDSatggcagccgatgccccgggagaccggatggaggagcccctgcccgacagggccgtgccc
atttacgtggctgggtttttggccctgtatgacagccggggactcgggcgagttggcatt
ggatccggatacggtgcgggcggccctgcctccggataacccactcccgattaacgtgga
ccaccgcgctggctgcgaggtggggcgggtgctggccgtggtcgacgacccccgtgggcc
gttttttgtggggctgatcgcctgcgtgcagctggagcgcgtcctcgagacggccgccag
cgctgcgattttcgagcgccgcgggccgccgctctcccgggaggagcgcctgttgtacct
gatcaccaactacctgccctcggtctccctggccacaaaacgcctggggggcgaggcgca
ccccgatcgcacgctgttcgcgcacgtcgcgctgtgcgcgatcgggcggcgcctgcgcac
tatcgtcacctacgacaccggtctcgacgccgccatcgcgccctttcgccacctgtcgcc
ggcgtctcgcgagggggcgcggcgactggccgccgaggccgagctcgctctgtccgggcg
cacctgggcgcccggcgtggaggcgctgacccacacgctgctttccaccgccgttaacaa
catgatgctgcgggaccgctggagcctggtggccgagcggcggcggcaggccgggatcgc
cggacacacctacctgcaggcgtga
atggctgctgacgctccgggtgaccgtatggaagaaccgctgccggaccgtgctgttccg
atctacgttgctggtttcctggctctgtacgactccgtgactccggtgaactggctctgg
acccggacaccgttcgtgctgctctgccgccggacaacccgtgccgatcaacgttgacca
ccgtgctggttgcgaagttggtcgtgttctggctgttgttgacgaccgcgtggtccgttc
ttcgttggtctgatcgcttgcgttcagctggaacgtgttctggaaaccgctgcttccgct
gctatcttcgaacgtcgtggtccgccgctgtcccgtgaagaacgtctgctgtacctgatc
accaactacctgccgtccgtttccctggctaccaaacgtctgggtggtgaagctcacccg
gaccgtaccctgttcgctcacgttgctctgtgcgctatcggtcgtcgtctgggtaccatc
gttacctacgacaccggtctggacgctgctatcgctccgttccgtcacctgtccccggct
tcccgtgaaggtgctcgtcgtctggctgctgaagctgaactggctctgtccggtcgtacc
tgggctccgggtgttgaagctctgacccacaccctgctgtccaccgctgttaacaacatg
atgctgcgtgaccgttggtccctggttgctgaacgtcgtcgtcaggctggtatcgctggt
cacacctacctgcaggcttga
5' Endgaattccgcggtggtgccgaattccgcggtggtgcc
3' Endggatccgaattcggatccgaattc
Notes
Expression VectorpES18.10 L
Assay MethodsSDS/PAGE, western blot, ultraviolet absorbanceSDS/PAGE, western blot, ultraviolet absorbance
Results0.03-0.04 mg/l purified protease with natural gene and 5-8 mg protease was purified for recoded(20 times more than the natural gene)0.03-0.04 mg/l purified protease from natural expression and 5-8 mg protease was purified from the recoded gene(20 times more than the natural gene)
Protein Functionprotease, capsid assembly protein
Recoding PurposeTo improve expression
Synthesized ByGenosys Biotechnologies Inc.
Recoding MethodBack translation of the amino acid sequence using the GenRunData:-ecohigh.cod frequency file from
the Genetics Computer Group Software and cloned into the EcoR1 site of pUC18
Publication Author(s)Apeler, H.; Gottschalk, U.; Guntermann, D.; Hansen, J.; Massen, J.; Schmidt, E.; Schneider, K. H.; Schneidereit, M.; Rubsamen-Waigmann, H.
Corresponding Author
Corresponding AddressPharma Research, Bayer AG, Wuppertal, Germany.
Publication Year1997
Publication TitleExpression of natural and synthetic genes encoding herpes simplex virus 1 protease in Escherichia coli and purification of the protein
AbstractAn attractive target for anti-herpes chemotherapy is the herpes simplex virus 1 (HSV-1) protease encoded by the UL26 gene. Studies with HSV-1 strains that harbour mutations in the protease gene have demonstrated that the protease is essential for DNA packaging and virus maturation. The UL26 translation product is 635 amino acids long and undergoes autoproteolytic processing between residues Ala247/Ser248 and Ala610/Ser611. The N-terminal processing product (amino acids 1-247) contains the protease domain. To perform crystallization studies and high throughput screening for potent inhibitors, large amounts of the HSV-1 protease are required. However, expression of the natural HSV-1 protease gene in Escherichia coli using a T7-promoter-regulated system is low and does not allow for the efficient production of larger amounts of highly purified enzyme. In this report, we describe the use of a synthetic protease gene with optimized E. coli codon usage. The level of protease expression was at least 20 times higher with the synthetic gene as compared to the natural UL26 gene. The HSV-1 protease was purified to homogeneity in three steps using mixed-bed ion-exchange chromatography, affinity chromatography, and hydroxyapatite chromatography.
JournalEur J Biochem. 247(3): 890-5.
SummaryHerpes simplex virus 1 is high in occurrence in the human population. A new way to battle the virus, being researched, is to hinder the viral protease which is needed for DNA packing and virus maturation. The UL26 protease gene was recoded to enhance the amount of protease for other studies. The recoded gene was cloned into the vector pES18.10 L and transformed into E.coli. Through purification, the protease was extracted. The original gene needed a C-terminal or N-terminal fusion, which the recoded gene eliminates. The results was a 20 time increase in the production of protease Comment: In nucleotide strain, yellow is the 5’ end and the blue is the 3’end.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=616
PubMed ID9288912
Submitter NameNolan, Katie
Submitter Address1000 Hilltop Cr., Baltimore, Maryland 21250, U.S.A
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site