Synthetic Gene DataBase
 

Synthetic Gene 217


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID197217
GenBank AccessionM62654
GenBank GI155662
Gene NamewtGFPLGFP
Gene Length (bp)7170
SpeciesAequorea victoriaHistoplasma capsulatum
StrainsG184ASura5
CDSatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatgggcacaaattctctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaagctacctgttccatggccaacactt
gtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaaacag
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatattttac
aaagatgacgggaactacaaatcacgtgctgaagtcaagtttgaaggtgataccctcgtt
aatagaattgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
atggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttccaaagatcccaacgaaaagagagatcacatgatcctt
cttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataa
5' End
3' End
NotesThere were not tests using the natural gene. The CDS for the GFP gene was taken based on the references in the article and the NBCI database.
Expression VectorpBY33, pSK22
Assay MethodsFluorescence microscopy, Western Blot
ResultsVery little amounts (very weak fluorescence)
Protein FunctionReporter gene
Recoding PurposeTo improve expression
Synthesized ByHa, D.S., Schwarz, J.K., Turco, S.J., Beverley, S.
Recoding MethodCodon optimization based on the codon usage patterns of Homo sapiens. In addition 2 amino acids were
exchanges.
Publication Author(s)Kugler, S.; Young, B.; Miller, V. L.; Goldman, W. E.
Corresponding AuthorWilliam E. Goldman
Corresponding AddressDepartment of Molecular Microbiology, Washington University School of Medicine, St. Louis, MO 63110, USA.
Publication Year2000
Publication TitleMonitoring phase-specific gene expression in Histoplasma capsulatum with telomeric GFP fusion plasmids
AbstractDimorphism is an essential feature of Histoplasma capsulatum pathogenesis, and much attention has been focused on characteristics that are unique to the saprophytic mycelial phase or the parasitic yeast phase. Recently, we identified a secreted calcium-binding protein, CBP, that is produced in large amounts by yeast cells but is undetectable in mycelial cultures. In this study, the green fluorescent protein (GFP) was established as a reporter in H. capsulatum to study regulation of CBP1 expression in cultures and in single cells grown under different conditions and inside macrophages. One GFP version that was optimized for human codon usage yielded highly fluorescent Histoplasma yeast cells. By monitoring GFP fluorescence during the transition from mycelia to yeast, we demonstrated that the CBP1 promoter is only fully active after complete morphological conversion to the yeast form, indicating for the first time that CBP1 is developmentally regulated rather than simply temperature regulated. Continuous activity of the CBP1 promoter during infection of macrophages supports the hypothesis that CBP secretion plays an important role for Histoplasma survival within the phagolysosome. Broth cultures of Histoplasma yeasts carrying a CBP-GFP protein fusion construct were able to secrete a full-length fluorescent fusion protein that remained localized within the phagolysosomes of infected macrophages. Additionally, a comparison of two Histoplasma strains carrying the CBP1 promoter fusion construct either epichromosomally or integrated into the chromosome revealed cell-to-cell variation in plasmid copy number due to uneven plasmid partitioning into daughter cells.
JournalCell Microbiol. 2(6): 537-47.
SummaryHistoplasma capsulatum was transofomed with four versions of the natural wtGFP gene, GFPmut 2, SaGFP, LGFP, and sGFP, in order to increase the expression of GFP (Green fluorescence protein) in H. capsilatum. LGFP and sGFP were both codon optimized based on the codon usage of highly expressed Homo sapien genes. GFPmut 2 and SaGFP were codon optimized based on the codon usage patterns of E. coli and S. cerevisiae, respectively. GFPmut 2 and saGFP did not produce any GFP protein and LGFP only produced a weak fluroescene, but sGFP was able to produce fully functional and highly fluorescent GFP protein. Two of the four recoded genes were functional, but only one was able to produce a high functional amount of GFP. Overall, the recoded gene can be considered successful since the protein level and functionality increased and GFP was able to perform its reporter duty.
CommentsThere were in total, 4 recoded genes used for this experiment, GFPmut 2, SaGFP, LGFP, and sGFP. There were no quantitative tests for the GFP protein levels, only fluorescence was detected.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=540
PubMed ID11207606
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site