Synthetic Gene DataBase
 

Synthetic Gene 219


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID48219
GenBank AccessionM11068
GenBank GI142721
Gene Namecry1Acsynthetic cry1Ac
Gene Length (bp)35373537
SpeciesBacillus thuringiensisEscherichia coli
StrainsBL21 Codon(+)
CDSatggataacaatccgaacatcaatgaatgcattccttataattgtttaagtaaccctgaa
gtagaagtattaggtggagaaagaatagaaactggttacaccccaatcgatatttccttg
tcgctaacgcaatttcttttgagtgaatttgttcccggtgctggatttgtgttaggacta
gttgatataatatggggaatttttggtccctctcaatgggacgcatttcttgtacaaatt
gaacagttaattaaccaaagaatagaagaattcgctaggaaccaagccatttctagatta
gaaggactaagcaatctttatcaaatttacgcagaatcttttagagagtgggaagcagat
cctactaatccagcattaagagaagagatgcgtattcaattcaatgacatgaacagtgcc
cttacaaccgctattcctctttttgcagttcaaaattatcaagttcctcttttatcagta
tatgttcaagctgcaaatttacatttatcagttttgagagatgtttcagtgtttggacaa
aggtggggatttgatgccgcgactatcaatagtcgttataatgatttaactaggcttatt
ggcaactatacagattatgctgtacgctggtacaatacgggattagaacgtgtatgggga
ccggattctagagattgggtaaggtataatcaatttagaagagaattaacactaactgta
ttagatatcgttgctctgttcccgaattatgatagtagaagatatccaattcgaacagtt
tcccaattaacaagagaaatttatacaaacccagtattagaaaattttgatggtagtttt
cgaggctcggctcagggcatagaaagaagtattaggagtccacatttgatggatatactt
aacagtataaccatctatacggatgctcataggggttattattattggtcagggcatcaa
ataatggcttctcctgtagggttttcggggccagaattcacttttccgctatatggaact
atgggaaatgcagctccacaacaacgtattgttgctcaactaggtcagggcgtgtataga
acattatcgtccactttatatagaagaccttttaatatagggataaataatcaacaacta
tctgttcttgacgggacagaatttgcttatggaacctcctcaaatttgccatccgctgta
tacagaaaaagcggaacggtagattcgctggatgaaataccgccacagaataacaacgtg
ccacctaggcaaggatttagtcatcgattaagccatgtttcaatgtttcgttcaggcttt
agtaatagtagtgtaagtataataagagctcctatgttctcttggatacatcgtagtgct
gaatttaataatataattgcatcggatagtattactcaaatccctgcagtgaagggaaac
tttctttttaatggttctgtaatttcaggaccaggatttactggtggggacttagttaga
ttaaatagtagtggaaataacattcagaatagagggtatattgaagttccaattcacttc
ccatcgacatctaccagatatcgagttcgtgtacggtatgcttctgtaaccccgattcac
ctcaacgttaattggggtaattcatccattttttccaatacagtaccagctacagctacg
tcattagataatctacaatcaagtgattttggttattttgaaagtgccaatgcttttaca
tcttcattaggtaatatagtaggtgttagaaattttagtgggactgcaggagtgataata
gacagatttgaatttattccagttactgcaacactcgaggctgaatataatctggaaaga
gcgcagaaggcggtgaatgcgctgtttacgtctacaaaccaactagggctaaaaacaaat
gtaacggattatcatattgatcaagtgtccaatttagttacgtatttatcggatgaattt
tgtctggatgaaaagcgagaattgtccgagaaagtcaaacatgcgaagcgactcagtgat
gaacgcaatttactccaagattcaaatttcaaagacattaataggcaaccagaacgtggg
tggggcggaagtacagggattaccatccaaggaggggatgacgtatttaaagaaaattac
gtcacactatcaggtacctttgatgagtgctatccaacatatttgtatcaaaaaatcgat
gaatcaaaattaaaagcctttacccgttatcaattaagagggtatatcgaagatagtcaa
gacttagaaatctatttaattcgctacaatgcaaaacatgaaacagtaaatgtgccaggt
acgggttccttatggccgctttcagcccaaagtccaatcggaaagtgtggagagccgaat
cgatgcgcgccacaccttgaatggaatcctgacttagattgttcgtgtagggatggagaa
aagtgtgcccatcattcgcatcatttctccttagacattgatgtaggatgtacagactta
aatgaggacctaggtgtatgggtgatctttaagattaagacgcaagatgggcacgcaaga
ctagggaatctagagtttctcgaagagaaaccattagtaggagaagcgctagctcgtgtg
aaaagagcggagaaaaaatggagagacaaacgtgaaaaattggaatgggaaacaaatatc
gtttataaagaggcaaaagaatctgtagatgctttatttgtaaactctcaatatgatcaa
ttacaagcggatacgaatattgccatgattcatgcggcagataaacgtgttcatagcatt
cgagaagcttatctgcctgagctgtctgtgattccgggtgtcaatgcggctatttttgaa
gaattagaagggcgtattttcactgcattctccctatatgatgcgagaaatgtcattaaa
aatggtgattttaataatggcttatcctgctggaacgtgaaagggcatgtagatgtagaa
gaacaaaacaaccaacgttcggtccttgttgttccggaatgggaagcagaagtgtcacaa
gaagttcgtgtctgtccgggtcgtggctatatccttcgtgtcacagcgtacaaggaggga
tatggagaaggttgcgtaaccattcatgagatcgagaacaatacagacgaactgaagttt
agcaactgcgtagaagaggaaatctatccaaataacacggtaacgtgtaatgattatact
gtaaatcaagaagaatacggaggtgcgtacacttctcgtaatcgaggatataacgaagct
ccttccgtaccagctgattatgcgtcagtctatgaagaaaaatcgtatacagatggacga
agagagaatccttgtgaatttaacagagggtatagggattacacgccactaccagttggt
tatgtgacaaaagaattagaatacttcccagaaaccgataaggtatggattgagattgga
gaaacggaaggaacatttatcgtggacagcgtggaattactccttatggaggaatag
5' End
3' End
NotesThe wild-type gene is reported by Adang et al. 1985The sequence for the synthetic gene was not provided in the paper. Auhtors were emailed on 02/03/06.
Expression VectorNApET43.1a, pET11d
Assay MethodsNASDS-PAGE
ResultsExpression not determinedCodon optimized gene can be overexpressed in a strain of E. coli (BL21 codon plus).
Protein Functioncrystal protein
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon usage was optimized for expression in E. coli.
Publication Author(s)Kumar, S.; Birah, A.; Chaudhary, B.; Burma, P. K.; Gupta, G. P.; Pental, D.
Corresponding AuthorD. Pental
Corresponding AddressDepartment of Genetics, University of Delhi South Campus, Benito Juarez Road, New Delhi 110021, India.
Publication Year2005
Publication TitlePlant codon optimized cry genes of Bacillus thuringiensis can be expressed as soluble proteins in Escherichia coli BL21 Codon Plus strain as NusA-Cry protein fusions
AbstractFor optimal expression of delta-endotoxins from Bacillus thuringiensis in plants, preferential changes in the codon sequences, and reduction in overall AT content in the nucleotide sequence of the genes is important. Reports suggest that sequences with such modifications cannot be overexpressed in bacteria. We report here that the modified genes can be overexpressed in a strain of Escherichia coli carrying extra tRNA genes for some of the codons occurring at high frequency in plant genes and less preferred in E. coli. We also demonstrate that proteins when expressed as fusion products with NusA protein, are obtained as soluble fraction rather than in inclusion bodies. This allows easy and accurate LC50 analysis on insect pests.
JournalJ Invertebr Pathol. 88(1): 83-6.
Summary
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=529
PubMed ID15707873
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site