Synthetic Gene DataBase
 

Synthetic Gene 220


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID198220
GenBank AccessionAF168419
GenBank GI7105733
Gene NameDsRedDsRed1
Gene Length (bp)678753
SpeciesDiscosoma sp (coral)Nicotiana benthamiana, N. tabacum, N. occidentalis
Strains
CDSatgaggtcttccaagaatgttatcaaggagttcatgaggtttaaggttcgcatggaagga
acggtcaatgggcacgagtttgaaatagaaggcgaaggagaggggaggccatacgaaggc
cacaataccgtaaagcttaaggtaaccaaggggggacctttgccatttgcttgggatatt
ttgtcaccacaatttcagtatggaagcaaggtatatgtcaagcaccctgccgacatacca
gactataaaaagctgtcatttcctgaaggatttaaatgggaaagggtcatgaactttgaa
gacggtggcgtcgttactgtaacccaggattccagtttgcaggatggctgtttcatctac
aaggtcaagttcattggcgtgaactttccttccgatggacctgttatgcaaaagaagaca
atgggctgggaagccagcactgagcgtttgtatcctcgtgatggcgtgttgaaaggagag
attcataaggctctgaagctgaaagacggtggtcattacctagttgaattcaaaagtatt
tacatggcaaagaagcctgtgcagctaccagggtactactatgttgactccaaactggat
ataacaagccacaacgaagactatacaatcgttgagcagtatgaaagaaccgagggacgc
caccatctgttcctttaa
atggtgcgctcctccaagaacgtcatcaaggagttcatgcgcttcaaggtgcgcatggag
ggcaccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag
ggccacaacaccgtgaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac
atcctgtccccccagttccagtacggctccaaggtgtacgtgaagcaccccgccgacatc
cccgactacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttc
gaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggctgcttcatc
tacaaggtgaagttcatcggcgtgaacttcccctccgacggccccgtaatgcagaagaag
accatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggc
gagatccacaaggccctgaagctgaaggacggcggccactacctggtggagttcaagtcc
atctacatggccaagaagcccgtgcagctgcccggctactactacgtggactccaagctg
gacatcacctcccacaacgaggactacaccatcgtggagcagtacgagcgcaccgagggc
cgccaccacctgttcctgctcagatctcgagctcaagcttcgaattctgcagtcgacggt
accgcgggcccgggatccaccggatctagataa
5' End
3' End
NotesThe sequence was kindly provided by Dr. Maiss.
Expression VectorNApDsRed1-C1
Assay MethodsNAFluorescence imaging
ResultsExpression not determined.Strong fluorescent signal was observed in construct with further modification upstream but not in the orginal pDsRed1-C1 construct.
Protein FunctionReporter gene
Recoding PurposeTo improve expression
Synthesized ByClontech
Recoding MethodCodon usage was optimized for expression in human cells. In addition, the start codon was optimized
for expression in plants by introducing AACA right in front of the start codon. A Shine-Dalgarno
motif (AGGA) was generated nine nucletodies upstream of the start codon. A strong enhanced CaMV-35S
promoter was introduced as well.
Publication Author(s)Dietrich, C.; Maiss, E.
Corresponding AuthorEdgar Maiss
Corresponding AddressUniversity of Hannover, Germany.
Publication Year2002
Publication TitleRed fluorescent protein DsRed from Discosoma sp. as a reporter protein in higher plants
AbstractGFP from Aequorea victoria is a standard genetic marker widely used to visualize cellular events in a noninvasive manner. For simultaneous imaging of different processes, in vivo mutants of GFP with shifted wavelength spectra (e.g., blue fluorescent protein) are conventionally used. The recently reported red fluorescent protein from Discosoma sp., DsRed, represents a new marker that can be used together with GFP variants for multicolor imaging. DsRed is an interesting marker protein for use in plants because of its red-shifted wavelength spectrum that will avoid damaging cells and tissues by excitation light. In this report, we show that DsRed is an excellent marker in higher plants in spite of the interfering red autofluorescence of chlorophyll, which can be eliminated by using the appropriate filter sets. Transient expression of DsRed1-C1 and a soluble-modified, red-shifted GFP variant has been carried out both individually and jointly in the epidermal cells of three different Nicotiana species and Chenopodium quinoa, which gives rise to dual labeling in plants. For this purpose, a human codon-optimized variant of DsRed has been adopted for expression in plants. Moreover, the DsRed reporter gene was expressed by using a labeled plant viral vector derived from an infectious full-length clone of potato virus X.
JournalBiotechniques. 32(2): 286, 288-90, 292-3.
SummaryA human codon-optimized DsRed reporter gene was further modified in the 5'UTR and promoter region. In contrast with the unmodified construct, the modified one showed strong fluorescent signal in plant cells.
CommentsDetailed information on pDsRed1-C1 vector is availabe at http://orders.clontech.com/clontech/techinfo/vectors_dis/pDsRed1-C1.shtml
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=499
PubMed ID11848404
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site