Synthetic Gene DataBase
 

Synthetic Gene 221


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID199221
GenBank AccessionX14619
GenBank GI18291
Gene NameaglAaglAsyn
Gene Length (bp)12360
SpeciesCyamopsis tetragonolobaAspergillus awamori
StrainsAW15.7
CDSatggcaacgcattattcaattataggtgggatgattatagtggtgttgttgatgattatt
ggaagtgaaggtggtagattattagagaagaagaacagaacaagtgcagaggcagagcat
tataatgttaggagatatctggctgaaaatggactaggccagacacctcccatggggtgg
aatagctggaatcactttggctgtgatattaatgaaaacgtagttcgagaaacagctgat
gcaatggtttcaacggggcttgctgctttaggctaccaatatatcaatttagatgactgc
tgggccgaacttaatcgagacagtgagggaaatatggttccaaatgctgcagcatttcct
tcaggaattaaggctctagctgattatgttcacagcaaaggtttaaagttgggagtctat
tcagatgctggaaatcaaacatgtagtaaacgtatgcctggatcacttggacacgaagaa
caagatgcaaaaacatttgcctcatggggagttgattatttgaagtatgataactgtgag
aatttgggtataagcgtcaaagaaaggtacccaccaatgggtaaagcattattaagttct
ggaaggccaatcttcttctccatgtgtgaatggggatgggaagacccacaaatttgggcc
aaaagtataggaaatagttggagaacaactggagatattgaggacaactggaatagtatg
acttccatagcagattcaaatgataaatgggcatcttatgctggacctggaggatggaat
gatcctgacatgcttgaagttggaaatggagggatgaccacagaagaatatcgttcccat
ttcagcatttgggcattagctaaggctcctctgctggttggttgtgatattagagcaatg
gatgacaccactcatgaactgattagcaatgctgaagttattgcagtaaaccaagataaa
ctaggagttcaaggaaagaaagtaaaaagcactaatgatttggaggtatgggcaggtcct
ctaagtgataacaaggtggcagtgatcttatggaatagaagttcttcaagagcaacagtc
actgcatcctggtctgacataggcctacaacaaggaactacagttgatgcaagagattta
tgggagcactcaacacaatcattagtttctggagaaatatctgctgaaatagattcacat
gcttgcaagatgtatgttctgactccaaggagctga
5' End
3' End
Notes
Expression VectorpUR2303pUR2746
Assay MethodsNorthern Blot, Western BlotNorthern Blot, Western Blot
ResultsNo expressionVery little increase (0.2-0.4 mg/L as well as significant amounts of mRNA)
Protein FunctionCatalyzes the hydrolysis of galactose
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon optimized based on the codon usage patterns of yeast (Saccharomyces cerevisiae). A exlA
promoter was added as well as and exlA transcription terminator.
Publication Author(s)Gouka, R. J.; Punt, P. J.; Hessing, J. G.; van den Hondel, C. A.
Corresponding AuthorRobin J. Gouka
Corresponding AddressTNO Nutrition and Food Research Institute, Department of Molecular Genetics and Gene Technology, Rijswijk, The Netherlands.
Publication Year1996
Publication TitleAnalysis of heterologous protein production in defined recombinant Aspergillus awamori strains
AbstractA study was carried out to obtain more insight into the parameters that determine the secretion of heterologous proteins from filamentous fungi. A strategy was chosen in which the mRNA levels and protein levels of a number of heterologous genes of different origins were compared. All genes were under control of the Aspergillus awamori 1,4-beta-endoxylanase A (exlA) expression signals and were integrated in a single copy at the A. awamori pyrG locus. A Northern (RNA) analysis showed that large differences occurred in the steady-state mRNA levels obtained with the various genes; those levels varied from high values for genes of fungal origin (A. awamori 1,4-beta-endoxylanase A, Aspergillus niger glucoamylase, and Thermomyces lanuginosa lipase) to low values for genes of nonfungal origin (human interleukin 6 and Cyamopsis tetragonoloba [guar] alpha-galactosidase). With the C. tetragonoloba alpha-galactosidase wild-type gene full-length mRNA was even undetectable. Surprisingly, small amounts of full-length mRNA could be detected when a C. tetragonoloba alpha-galactosidase gene with an optimized Saccharomyces cerevisiae codon preference was expressed. In all cases except human interleukin 6, the protein levels corresponded to the amounts expected on basis of the mRNA levels. For human interleukin 6, very low protein levels were observed, whereas relatively high steady-state mRNA levels were obtained. Our data suggest that intracellular protein degradation is the most likely explanation for the low levels of secreted human interleukin 6.
JournalAppl Environ Microbiol. 62(6): 1951-7.
SummaryAspergillus awamori was transformed with a recoded version of the aglA gene, aglAsyn, in order to increase the expression of Alpha-galactosidase in A. awamori. The natural gene was codon optimized based on the codon usage patterns of yeast (Saccharomyces cerevisiae) in order to attain aglAsyn. aglAsyn was able to produce protein, albeit in small amounts, whereas the natural gene was not expressed at all. The recoded gene also provided a significant amount of mRNA. Though not a major success, the recoding was able to provide expression where the natural gene did not.
CommentsThe author was contacted on 2/3/2006 for the CDS of the recoded gene, but a reply was never received.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=531
PubMed ID8787393
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site