Synthetic Gene DataBase
 

Synthetic Gene 222


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID200222
GenBank AccessionAY207396
GenBank GI29027588
Gene NameAg85BhAg85B
Gene Length (bp)978962
SpeciesMycobacterium tuberculosisMus musculus
Strainsclinical isolate; drug resistant strainCT26, COS-7, Mouse Spleen cells
CDSatgacagacgtgagccgaaagattcgagcttggggacgccgattgatgatcggcacggca
gcggctgtagtccttccgggcctggtggggcttgccggcggagcggcaaccgcgggcgcg
ttctcccgcccggggctcccggttgagtacctgcaggtgccgtcgccgtcgatgggccgc
gacatcaaggttcagttccagagcggtgggaacaactcacctgcggtttatctgctcgac
ggcctgcgcgcccaagacgactacaacggctgggatatcaacaccccggcgttcgagtgg
tactaccagtcgggactgtcgatagtcatgccggtcggcgggcagtccagcttctacagc
gactggtacagcccggcctgcggtaaggctggctgccagacttacaagtgggaaaccttc
ctgaccagcgagctgccgcaatggttgtccgccaacagggccgtgaagcccaccggcagc
gctgcaatcggcttgtcgatggccggctcgtcggcaatgatcttggccgcctaccacccc
cagcagttcatctacgccggctcgctgtcggccctgctggacccctctcaagggatgggg
cctagcctgatcggcctcgcgatgggtgacgccggcggttacaaggccgcaaacatgtgg
ggtccctcgagtgacccggcatgggagcgcaacgaccctacgcagcagatcccaaagctg
gtcgcaaacaacacccggctatgggtttattgcgggaacggcaccccgaacgagttgggc
ggtgccaacatacccgccgagttcttgaagaacttcgttcgtagcagcaacctgaagttc
caggatgcgtacaacgccgcgggcgggcacaacgccgtgttcaacttcccgcccaacggc
acgcacagctgggagtactggggcgctcaactcaacgccatgaagggtgacctccagagt
tcgttaggcgccggctag
atgaccgacgtgagccgcaagatccgcgcttggggcgccgcctgatgatcggcaccgcag
ccgctgtggtcctgcccggcctggtggggctggccggcggcgccgcaaccgccggcgcct
tctcccggccgggcctgcccgtgcccagccccagcatgggccgcgacatcaaggtgcagt
tccagagcggcgggaacaactcccccgccgtgtatctgctcgacggcctgcgcgcccaag
acgactacaacggctgggatatcaacacccccgccttcgagtggtactaccagagcggcc
tgagcatcgtgatgcctgtgggcggccagtccagcttctacagcgactggtacagccctg
cctgcggcaaggctggctgccagacctacaagtgggagaccttcctgaccagcgagctcc
ctcagtggctgagcgccaaccacgccgtgaagcccaccggcagcgccgccatcggcctga
cgatggccggcagcagcgccatgatcctggccgcctaccacccccagcagttcatctacg
ccggcagcctgagcgccctgctggatccctcccagggcatgggacccagcctgatcggcc
tggccatgggcgacgccggcgggtacaaggccgccgacatgtggggcccctccagcgacc
ccgcctgggagcgcaacgaccctacccagcagatcccaacgctggtggccaacaacacgc
gtctgtgggtgtactgcggcaacggcacccccaacgagctgggcggagccaacatccccg
ccgagttcctcgagaacttcgtgcgcagctccaacctgaagttccaggacgcctacaacg
ccgccggcgggcacaacgccgtgttcaacttccctcccaacggtacccacagctgggagt
actggggcgcccaactgaacgccatgaagggcgacctccagtccagcctgggcgccggct
ag
5' End
3' End
Notes
Expression VectorpCKpCK
Assay MethodsELISA, Western Blot, ELISPOT,Luciferase Assay, Splenocyte prolifiration Assay, 51Cr release Assay, Student's t test, SigmaPlot 5.0 program.ELISA, Western Blot, ELISPOT,Luciferase Assay, Splenocyte prolifiration Assay, 51Cr release Assay, Student's t test, SigmaPlot 5.0 program.
ResultsLow expression.Increased expression.
Protein Functionfibronectin-binding
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon usage was optimized for expression in human cells.
Publication Author(s)Ko HJ, Ko SY, Kim YJ, Lee EG, Cho SN, Kang CY
Corresponding AuthorChang-Yuil Kang
Corresponding AddressLaboratory of Immunology and Institute of Pharmaceutical Sciences, College of Pharmacy, Seoul National University, Shillim-Dong, Kwanak-Gu, Seoul, 151-742, Republic of Korea.
Publication Year2005
Publication TitleOptimization of codon usage enhances the immunogenicity of a DNA vaccine encoding mycobacterial antigen Ag85B.
AbstractIn spite of its many other benefits, DNA vaccine is limited in its application by its insufficient immunogenicity. One promising approach for enhancing its immunogenicity is to maximize its expression in the immunized host. In the current study, we investigated whether codon optimization of the mycobacterial antigen Ag85B gene could enhance the expression and immunogenicity of the Ag85B DNA vaccine. We generated a synthetic humanized Ag85B (hAg85B) gene in which codon usage was optimized for expression in human cells. DNA plasmids with codon-optimized hAg85B increased the level of protein expression in vitro and in vivo. DNA vaccine with hAg85B induced stronger Th1-like and cytotoxic T-cell immune responses in BALB/c mice and generated higher protective immunity in a BALB/c mouse model of Mycobacterium tuberculosis aerosol infection than did the DNA vaccine with wild-type Ag85B. Therefore, our results suggest that codon optimization of mycobacterial antigens (e.g., Ag85B) could improve protein expression and thereby enhance the immunogenicity of DNA vaccines against M. tuberculosis.
JournalInfection and Immunity. 73(): 5666-74.
SummaryTo determine if codon optimization of Ag85B gene could increase the expression and the immunogenicity of the Ag85B DNA vaccine, a synthetic humanized Ag85B (hAg85B) gene was constructed. Codon usage was optimized for expression in human cells. According to the experimental results, hAg85B increased the protein expression, induced higher immune responses.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=650
PubMed ID16113284
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site