Synthetic Gene DataBase
 

Synthetic Gene 223


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID201223
GenBank AccessionU32207AY311508
GenBank GI97443432351461
Gene NameEBA-175EBA-175 (E. coli version)
Gene Length (bp)4263942
SpeciesPlasmodium falciparum 3D7Escherichia coli, Pichia pastoris
Strains3D7XL-1Blue cells, BL21(DE3) cells
CDSatgaaatgtaatattagtatatatttttttgcttccttctttgtgttatattttgcaaaa
gctaggaatgaatatgatataaaagagaatgaaaaatttttagacgtgtataaagaaaaa
tttaatgaattagataaaaagaaatatggaaatgttcaaaaaactgataagaaaatattt
acttttatagaaaataaattagatattttaaataattcaaaatttaataaaagatggaag
agttatggaactccagataatatagataaaaatatgtctttaataaataaacataataat
gaagaaatgtttaacaacaattatcaatcatttttatcgacaagttcattaataaagcaa
aataaatatgttcctattaacgctgtacgtgtgtctaggatattaagtttcctggattct
agaattaataatggaagaaatacttcatctaataacgaagttttaagtaattgtagggaa
aaaaggaaaggaatgaaatgggattgtaaaaagaaaaatgatagaagcaactatgtatgt
attcctgatcgtagaatccaattatgcattgttaatcttagcattattaaaacatataca
aaagagaccatgaaggatcatttcattgaagcctctaaaaaagaatctcaacttttgctt
aaaaaaaatgataacaaatataattctaaattttgtaatgatttgaagaatagtttttta
gattatggacatcttgctatgggaaatgatatggattttggaggttattcaactaaggca
gaaaacaaaattcaagaagtttttaaaggggctcatggggaaataagtgaacataaaatt
aaaaattttagaaaaaaatggtggaatgaatttagagagaaactttgggaagctatgtta
tctgagcataaaaataatataaataattgtaaaaatattccccaagaagaattacaaatt
actcaatggataaaagaatggcatggagaatttttgcttgaaagagataatagatcaaaa
ttgccaaaaagtaaatgtaaaaataatacattatatgaagcatgtgagaaggaatgtatt
gatccatgtatgaaatatagagattggattattagaagtaaatttgaatggcatacgtta
tcgaaagaatatgaaactcaaaaagttccaaaggaaaatgcggaaaattatttaatcaaa
atttcagaaaacaagaatgatgctaaagtaagtttattattgaataattgtgatgctgaa
tattcaaaatattgtgattgtaaacatactactactctcgttaaaagcgttttaaatggt
aacgacaatacaattaaggaaaagcgtgaacatattgatttagatgatttttctaaattt
ggatgtgataaaaattccgttgatacaaacacaaaggtgtgggaatgtaaaaaaccttat
aaattatccactaaagatgtatgtgtacctccgaggaggcaagaattatgtcttggaaac
attgatagaatatacgataaaaacctattaatgataaaagagcatattcttgctattgca
atatatgaatcaagaatattgaaacgaaaatataagaataaagatgataaagaagtttgt
aaaatcataaataaaactttcgctgatataagagatattataggaggtactgattattgg
aatgatttgagcaatagaaaattagtaggaaaaattaacacaaattcaaattatgttcac
aggaataaacaaaatgataagctttttcgtgatgagtggtggaaagttattaaaaaagat
gtatggaatgtgatatcatgggtattcaaggataaaactgtttgtaaagaagatgatatt
gaaaatataccacaattcttcagatggtttagtgaatggggtgatgattattgccaggat
aaaacaaaaatgatagagactctgaaggttgaatgcaaagaaaaaccttgtgaagatgac
aattgtaaacgtaaatgtaattcatataaagaatggatatcaaaaaaaaaagaagagtat
aataaacaagccaaacaataccaagaatatcaaaaaggaaataattacaaaatgtattct
gaatttaaatctataaaaccagaagtttatttaaagaaatactcggaaaaatgttctaac
ctaaatttcgaagatgaatttaaggaagaattacattcagattataaaaataaatgtacg
atgtgtccagaagtaaaggatgtaccaatttctataataagaaataatgaacaaacttcg
caagaagcagttcctgaggaaagcactgaaatagcacacagaacggaaactcgtacggat
gaacgaaaaaatcaggaaccagcaaataaggatttaaagaatccacaacaaagtgtagga
gagaacggaactaaagatttattacaagaagatttaggaggatcacgaagtgaagacgaa
gtgacacaagaatttggagtaaatcatggaatacctaagggtgaggatcaaacgttagga
aaatctgacgccattccaaacataggcgaacccgaaacgggaatttccactacagaagaa
agtagacatgaagaaggccacaataaacaagcattgtctacttcagtcgatgagcctgaa
ttatctgatacacttcaattgcatgaagatactaaagaaaatgataaactacccctagaa
tcatctacaatcacatctcctacggaaagtggaagttctgatacagaggaaactccatct
atctctgaaggaccaaaaggaaatgaacaaaaaaaacgtgatgacgatagtttgagtaaa
ataagtgtatcaccagaaaattcaagacctgaaactgatgctaaagatacttctaacttg
ttaaaattaaaaggagatgttgatattagtatgcctaaagcagttattgggagcagtcct
aatgataatataaatgttactgaacaaggggataatatttccggggtgaattctaaacct
ttatctgatgatgtacgtccagataaaaatcatgaagaggtgaaagaacatactagtaat
tctgataatgttcaacagtctggaggaattgttaatatgaatgttgagaaagaactaaaa
gatactttagaaaatccttctagtagcttggatgaaggaaaagcacatgaagaattatca
gaaccaaatctaagcagtgaccaagatatgtctaatacacctggacctttggataacacc
agtgaagaaactacagaaagaattagtaataatgaatataaagttaacgagagggaaggt
gagagaacgcttactaaggaatatgaagatattgttttgaaaagtcatatgaatagagaa
tcagacgatggtgaattatatgacgaaaattcagacttatctactgtaaatgatgaatca
gaagacgctgaagcaaaaatgaaaggaaatgatacatctgaaatgtcgcataatagtagt
caacatattgagagtgatcaacagaaaaacgatatgaaaactgttggtgatttgggaacc
acacatgtacaaaacgaaattagtgttcctgttacaggagaaattgatgaaaaattaagg
gaaagtaaagaatcaaaaattcataaggctgaagaggaaagattaagtcatacagatata
cataaaattaatcctgaagatagaaatagtaatacattacatttaaaagatataagaaat
gaggaaaacgaaagacacttaactaatcaaaacattaatattagtcaagaaagggatttg
caaaaacatggattccataccatgaataatctacatggagatggagtttccgaaagaagt
caaattaatcatagtcatcatggaaacagacaagatcgggggggaaattctgggaatgtt
ttaaatatgagatctaataataataattttaataatattccaagtagatataatttatat
gataaaaaattagatttagatctttatgaaaacagaaatgatagtacaacaaaagaatta
ataaagaaattagcagaaataaataaatgtgagaacgaaatttctgtaaaatattgtgac
catatgattcatgaagaaatcccattaaaaacatgcactaaagaaaaaacaagaaatctg
tgttgtgcagtatcagattactgtatgagctattttacatatgattcagaggaatattat
aattgtacgaaaagggaatttgatgatccatcttatacatgtttcagaaaggaggctttt
tca
ggcaacgataacaccattaaagaaaaacgtgaacatattgatctggatgattttagcaaa
tttggctgcgataaaaacagcgtggataccaacaccaaagtgtgggaatgcaaaaaaccg
tataaactgagcaccaaagatgtgtgcgtgccgccgcgtcgtcaggaactgtgcctgggc
aacattgatcgtatttatgataaaaacctgctgatgattaaagaacatattctggcgatt
gcgatttatgaaagccgtattctgaaacgtaaatataaaaacaaagatgataaagaagtg
tgcaaaattattaacaaaacctttgcggatattcgtgatattattggcggcaccgattat
tggaacgatctgagcaaccgtaaactggtgggcaaaattaacaccaacagcaactatgtg
catcgtaacaaacagaacgataaactgtttcgtgatgaatggtggaaagtgattaaaaaa
gatgtgtggaacgtgattagctgggtgtttaaagataaaaccgtgtgcaaagaagatgat
attgaaaacattccgcagttttttcgttggtttagcgaatggggcgatgattattgccag
gataaaaccaaaatgattgaaaccctgaaagtggaatgcaaagaaaaaccgtgcgaagat
gataactgcaaacgtaaatgcaacagctataaagaatggattagcaaaaaaaaagaagaa
tataacaaacaggcgaaacagtatcaggaatatcagaaaggcaacaactataaaatgtat
agcgaatttaaaagcattaaaccggaagtgtatctgaaaaaatatagcgaaaaatgcagc
aacctgaactttgaagatgaatttaaagaagaactgcatagcgattataaaaacaaatgc
accatgtgcccggaagtgaaagatgtgccgattagcattatt
5' End
3' End
NotesEncodes F segment, Accession provided by the authors.Accession # is provided in the article.
Expression VectorpQE60, picZalpha.pQE60
Assay MethodsELISA, Western Blotting, Immunofluorescence, Assays for erythrocyte binding and inhibition of erythrocyte binding, Assay for inhibition of receptor binding.ELISA, Western Blotting, Immunofluorescence, Assays for erythrocyte binding and inhibition of erythrocyte binding, Assay for inhibition of receptor binding.
ResultsUndetectable.Significant increase.
Protein FunctionSialic acid-binding protein
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodBy using th emost frequrntly used codons for E. coli.
Publication Author(s)Yadava, A.; Ockenhouse, C. F.
Corresponding AuthorAnjali Yadava
Corresponding AddressDepartment of Immunology, Walter Reed Army Institute of Research, Silver Spring, Maryland 20910, USA.
Publication Year2003
Publication TitleEffect of codon optimization on expression levels of a functionally folded malaria vaccine candidate in prokaryotic and eukaryotic expression systems
AbstractWe have produced two synthetic genes that code for the F2 domain located within region II of the 175-kDa Plasmodium falciparum erythrocyte binding antigen (EBA-175) to determine the effects of codon alteration on protein expression in homologous and heterologous host systems. EBA-175 plays a key role in the process of merozoite invasion into erythrocytes through a specific receptor-ligand interaction. The F2 domain of EBA-175 is the ligand that binds to the glycophorin A receptor on human erythrocytes and is therefore a target of vaccine development efforts. We designed synthetic genes based on P. falciparum, Escherichia coli, and Pichia codon usage and expressed recombinant F2 in E. coli and Pichia pastoris. Compared to the expression of the native F2 sequence, conversion to prokaryote (E. coli)- or eukaryote (Pichia)-based codon usage dramatically improved the levels of recombinant protein expression in both E. coli and P. pastoris. The majority of the protein expressed in E. coli, however, was produced as inclusion bodies. The protein expressed in P. pastoris, on the other hand, was expressed as a secreted, soluble protein. The P. pastoris-produced protein was superior to that produced in E. coli based on its ability to bind to red blood cells. Consistent with these observations, the antibodies generated against the Pichia-produced protein prevented the binding of recombinant EBA to red blood cells. These antibodies recognize EBA-175 present on merozoites as well as in sporozoites by immunofluorescence. Our results suggest that the Pichia-based EBA-F2 vaccine construct has further potential to be developed for clinical use.
JournalInfect Immun. 71(9): 4961-9.
SummaryTo determine the effects of codon optimization on protein expression, two synthetic genes which code for the F2 domain located within region II of the EBA-175 were constructed. F2 gene constructs were made based on the native P.falciparum codons, E. coli codons, and Pichia codons. The E. coli codon-optimized construct was made by using most frequently used codons for E. coli. The Pichia codon-optimized construct was made by using most commonly used codons for Pichia, but codons for lysine, aspartic acid, glutamic acid, and asparagines were altered to prevent the potential depletion of those tRNA due to high usage. The experimental results showed that the expressions of both codon-optimized genes were significantly higher than that of the native gene.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=634
PubMed ID12933838
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site