Synthetic Gene DataBase
 

Synthetic Gene 228


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID202228
GenBank AccessionM62653
GenBank GI155660
Gene Namegreen fluorescent protein (GFP)rxYFP (202,225)
Gene Length (bp)717783
SpeciesAequorea victoriaEscherichia coli
Strainslambda gt10BL21 (DE3)
CDSatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacactt
gtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaaacag
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgtt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtcctt
cttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataa
atgaccatgattacgccaagcttgcatgcctgcaggtcgactctagaggatccccgggta
ccgcatatgtctaaaggtgaagaactgtttacgggtgttgtgccgatcctggtggaactg
gatggtgatgtgaacggtcataaattctctgtgtctggtgaaggtgaaggtgatgcaacc
tacggtaagctgaccctgaaatttatcgttaccacgggtaaactgccggttccatggccg
accctggtgaccaccttcgcgtatggtctgcaatgctttgcgcgctacccggatcacatg
aaacgtcacgactttttcaaatctgccatgccggaaggttatgtacaggaacgtaccatc
ttcttcaaagatgacggtaactacaaaacccgtgctgaagtgaaatttgaaggtgatacc
ctggtgaaccgtatcgaactgaaaggtattgattttaaagaagatggtaacatcctgggc
cataaactggaatacaactacaactctcataacgtatacatcgtggcagacaaacagaaa
aacggtatcaaagtgaacttcaaaatccgtcataacatcgaagatggttctgttcaactg
gcagaccattatcagcagaacaccccaattggcgatggcccggtgctgctgccggacaac
cattacctgtgcacgcagtctgccctttcgaaagatccgaacgaaaaacgtgaccacatg
gtgctgctggaatttgtgtgcgctgccggcatcacgcatggcatgcatgagctgtataaa
taa
5' End
3' End
Notes Source of the wld type GFP gene was not specified in the paper. Therefore, the M62653 was collected.This construct contains lacZ sequence in the first 66 bp. Therefore, Cys48 is actually Cys70. Relative to wild-type GFP, this protein contains amino acid substitutions at: S65A, V68L, S72A, Q80R, M153V, T203Y, D234H (all these numbers refer to original GFP protein).
Expression VectorNApET24
Assay MethodsNAFluorescence imaging
ResultsExpression not determinedIt exhibited ~1.2 fold changes in fluorescent actitivty between reduced and oxidized states.
Protein FunctionReporter gene
Recoding PurposeTo modify the function
Synthesized ByAuthors (degenerate primers)
Recoding MethodThis mutant was constructed a GFP construct codon optimized for expression in E. coli (by Hansen,
FG, unpublished, Accession: AF325903). The cysteine48 was changed to valine in this construct. Sites
202 and 225 were modified to Cys codons (TGC).
Publication Author(s)Ostergaard H, Henriksen A, Hansen FG, Winther JR.
Corresponding AuthorJakob R. Winther
Corresponding AddressSection of Molecular Microbiology, BioCentrum-DTU, Technical University of Denmark, Building 301, DK-2800 Lyngby, Denmark.
Publication Year2001
Publication TitleShedding light on disulfide bond formation: engineering a redox switch in green fluorescent protein.
AbstractTo visualize the formation of disulfide bonds in living cells, a pair of redox-active cysteines was introduced into the yellow fluorescent variant of green fluorescent protein. Formation of a disulfide bond between the two cysteines was fully reversible and resulted in a >2-fold decrease in the intrinsic fluorescence. Inter conversion between the two redox states could thus be followed in vitro as well as in vivo by non-invasive fluorimetric measurements. The 1.5 A crystal structure of the oxidized protein revealed a disulfide bond-induced distortion of the beta-barrel, as well as a structural reorganization of residues in the immediate chromophore environment. By combining this information with spectroscopic data, we propose a detailed mechanism accounting for the observed redox state-dependent fluorescence. The redox potential of the cysteine couple was found to be within the physiological range for redox-active cysteines. In the cytoplasm of Escherichia coli, the protein was a sensitive probe for the redox changes that occur upon disruption of the thioredoxin reductive pathway.
JournalEMBO J.. 20(21): 5853-62.
SummaryThis study attempted to construct a reporter protein that allowed the detection of celluar redox changes. To do this, a codon optimized (for E. coli) YFP (GFP?) was further mutated to remove the original Cys at site 48 and introduce a pair of Cys at other sites (four variants). One of the four variants was able to give a 2.2 fold of change in fluorescent activity. Precisely, this is a recoded protein rather than a recoded gene.
CommentsNote the GFP with the accession no.(AF325903) is already optimized for E. coli codon usage in an unpublished work by Hanson. The first 66 nt of the lac-GFP fusion gene code for lacZ. Therefore, only the wild-type GFP sequence was collected as the natural gene in this record. Notably, it seems that the template used as wtYFP (AF325903) contains a T at site 203 but not Y, it is contradictory with what is said in the introduction.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=524
PubMed ID11689426
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site