Synthetic Gene DataBase
 

Synthetic Gene 229


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID203229
GenBank AccessionAY274119
GenBank GI30248028
Gene NameSpikenSpike
Gene Length (bp)37680
SpeciesSARS coronavirus Tor2Mus musculus
StrainsTor2293, 293T cells, mouse spleen cells
CDSatgtttattttcttattatttcttactctcactagtggtagtgaccttgaccggtgcacc
acttttgatgatgttcaagctcctaattacactcaacatacttcatctatgaggggggtt
tactatcctgatgaaatttttagatcagacactctttatttaactcaggatttatttctt
ccattttattctaatgttacagggtttcatactattaatcatacgtttggcaaccctgtc
ataccttttaaggatggtatttattttgctgccacagagaaatcaaatgttgtccgtggt
tgggtttttggttctaccatgaacaacaagtcacagtcggtgattattattaacaattct
actaatgttgttatacgagcatgtaactttgaattgtgtgacaaccctttctttgctgtt
tctaaacccatgggtacacagacacatactatgatattcgataatgcatttaattgcact
ttcgagtacatatctgatgccttttcgcttgatgtttcagaaaagtcaggtaattttaaa
cacttacgagagtttgtgtttaaaaataaagatgggtttctctatgtttataagggctat
caacctatagatgtagttcgtgatctaccttctggttttaacactttgaaacctattttt
aagttgcctcttggtattaacattacaaattttagagccattcttacagccttttcacct
gctcaagacatttggggcacgtcagctgcagcctattttgttggctatttaaagccaact
acatttatgctcaagtatgatgaaaatggtacaatcacagatgctgttgattgttctcaa
aatccacttgctgaactcaaatgctctgttaagagctttgagattgacaaaggaatttac
cagacctctaatttcagggttgttccctcaggagatgttgtgagattccctaatattaca
aacttgtgtccttttggagaggtttttaatgctactaaattcccttctgtctatgcatgg
gagagaaaaaaaatttctaattgtgttgctgattactctgtgctctacaactcaacattt
ttttcaacctttaagtgctatggcgtttctgccactaagttgaatgatctttgcttctcc
aatgtctatgcagattcttttgtagtcaagggagatgatgtaagacaaatagcgccagga
caaactggtgttattgctgattataattataaattgccagatgatttcatgggttgtgtc
cttgcttggaatactaggaacattgatgctacttcaactggtaattataattataaatat
aggtatcttagacatggcaagcttaggccctttgagagagacatatctaatgtgcctttc
tcccctgatggcaaaccttgcaccccacctgctcttaattgttattggccattaaatgat
tatggtttttacaccactactggcattggctaccaaccttacagagttgtagtactttct
tttgaacttttaaatgcaccggccacggtttgtggaccaaaattatccactgaccttatt
aagaaccagtgtgtcaattttaattttaatggactcactggtactggtgtgttaactcct
tcttcaaagagatttcaaccatttcaacaatttggccgtgatgtttctgatttcactgat
tccgttcgagatcctaaaacatctgaaatattagacatttcaccttgcgcttttgggggt
gtaagtgtaattacacctggaacaaatgcttcatctgaagttgctgttctatatcaagat
gttaactgcactgatgtttctacagcaattcatgcagatcaactcacaccagcttggcgc
atatattctactggaaacaatgtattccagactcaagcaggctgtcttataggagctgag
catgtcgacacttcttatgagtgcgacattcctattggagctggcatttgtgctagttac
catacagtttctttattacgtagtactagccaaaaatctattgtggcttatactatgtct
ttaggtgctgatagttcaattgcttactctaataacaccattgctatacctactaacttt
tcaattagcattactacagaagtaatgcctgtttctatggctaaaacctccgtagattgt
aatatgtacatctgcggagattctactgaatgtgctaatttgcttctccaatatggtagc
ttttgcacacaactaaatcgtgcactctcaggtattgctgctgaacaggatcgcaacaca
cgtgaagtgttcgctcaagtcaaacaaatgtacaaaaccccaactttgaaatattttggt
ggttttaatttttcacaaatattacctgaccctctaaagccaactaagaggtcttttatt
gaggacttgctctttaataaggtgacactcgctgatgctggcttcatgaagcaatatggc
gaatgcctaggtgatattaatgctagagatctcatttgtgcgcagaagttcaatggactt
acagtgttgccacctctgctcactgatgatatgattgctgcctacactgctgctctagtt
agtggtactgccactgctggatggacatttggtgctggcgctgctcttcaaatacctttt
gctatgcaaatggcatataggttcaatggcattggagttacccaaaatgttctctatgag
aaccaaaaacaaatcgccaaccaatttaacaaggcgattagtcaaattcaagaatcactt
acaacaacatcaactgcattgggcaagctgcaagacgttgttaaccagaatgctcaagca
ttaaacacacttgttaaacaacttagctctaattttggtgcaatttcaagtgtgctaaat
gatatcctttcgcgacttgataaagtcgaggcggaggtacaaattgacaggttaattaca
ggcagacttcaaagccttcaaacctatgtaacacaacaactaatcagggctgctgaaatc
agggcttctgctaatcttgctgctactaaaatgtctgagtgtgttcttggacaatcaaaa
agagttgacttttgtggaaagggctaccaccttatgtccttcccacaagcagccccgcat
ggtgttgtcttcctacatgtcacgtatgtgccatcccaggagaggaacttcaccacagcg
ccagcaatttgtcatgaaggcaaagcatacttccctcgtgaaggtgtttttgtgtttaat
ggcacttcttggtttattacacagaggaacttcttttctccacaaataattactacagac
aatacatttgtctcaggaaattgtgatgtcgttattggcatcattaacaacacagtttat
gatcctctgcaacctgagcttgactcattcaaagaagagctggacaagtacttcaaaaat
catacatcaccagatgttgatcttggcgacatttcaggcattaacgcttctgtcgtcaac
attcaaaaagaaattgaccgcctcaatgaggtcgctaaaaatttaaatgaatcactcatt
gaccttcaagaattgggaaaatatgagcaatatattaaatggccttggtatgtttggctc
ggcttcattgctggactaattgccatcgtcatggttacaatcttgctttgttgcatgact
agttgttgcagttgcctcaagggtgcatgctcttgtggttcttgctgcaagtttgatgag
gatgactctgagccagttctcaagggtgtcaaattacattacacataa
5' End
3' End
NotesAccession # is not provided in the article. Thus, AY274119 is used.Contacted author on 2/4/06 for the seq.
Expression VectorAdHu5, AdC7AdHu5, AdC7
Assay MethodsWestern Blot, IFN-gamma ELISPOT assay, Intracellular IFN-gamma stainingWestern Blot, IFN-gamma ELISPOT assay, Intracellular IFN-gamma staining
ResultsUndetectableSignificant increase.
Protein FunctionSpike glycoprotein.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodRecoded with human pattern of codon usage according to Entelechon Backtranslation software tool.
Publication Author(s)Zhi, Y.; Kobinger, G. P.; Jordan, H.; Suchma, K.; Weiss, S. R.; Shen, H.; Schumer, G.; Gao, G.; Boyer, J. L.; Crystal, R. G.; Wilson, J. M.
Corresponding AuthorJames M. Wilson
Corresponding AddressGene Therapy Program, Division of Medical Genetics, Department of Medicine, University of Pennsylvania Health System, and The Wistar Institute, Philadelphia, PA 19104, USA.
Publication Year2005
Publication TitleIdentification of murine CD8 T cell epitopes in codon-optimized SARS-associated coronavirus spike protein
AbstractThe causative agent of severe acute respiratory syndrome (SARS) has been identified as a new type of coronavirus, SARS-associated coronavirus (SARS-CoV). CD8 T cells play an important role in controlling diseases caused by other coronaviruses and in mediating vaccine-induced protective immunity in corresponding animal models. The spike protein, a main surface antigen of SARS-CoV, is one of the most important antigen candidates for vaccine design. Overlapping peptides were used to identify major histocompatibility complex class I-restricted epitopes in mice immunized with vectors encoding codon-optimized SARS-CoV spike protein. CD8 T-cell responses were mapped to two H-2(b)-restricted epitopes (S436-443 and S525-532) and one H-2(d)-restricted epitope (S366-374). The identification of these epitopes will facilitate the evaluation of vaccine strategies in murine models of SARS-CoV infection. Furthermore, codon and promoter optimizations can greatly enhance the overall immunogenicity of spike protein in the context of replication-defective human and simian adenoviral vaccine carriers. The optimized recombinant adenoviral vaccine vectors encoding spike can generate robust antigen-specific cellular immunity in mice and may potentially be useful for control of SARS-CoV infection.
JournalVirology. 335(1): 34-45.
SummaryThe goal of this study is to identify murine CD8 T cell epitopes in codon-optimized SARS-associated coronavirus spike protein. For this purpose, synthetic spike gene sequence was designed with human pattern of codon usage. C57BL/6 mice and BALB/c mice were immunized with vectors encoding wild type spike and codon- optimized spike to identify CD8 T-cell epitopes. Results showed that the vector encoding codon-optimized spike generated strong spike-specific CD8 T-cell responses.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=658
PubMed ID15823604
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site