Synthetic Gene DataBase
 

Synthetic Gene 230


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID204230
GenBank AccessionAX029298AX029300
GenBank GI1019014910190151
Gene NameL1 (BPV1 L1)L1 (HB PV L1)
Gene Length (bp)14881488
SpeciesBovine papillomavirus type 1Cricetulus griseus, Cercopithecus aethiops
StrainsType 1CHO, Cos1 cells
CDSatggcgttgtggcaacaaggccagaagctgtatctccctccaacccctgtaagcaaggtg
ctttgcagtgaaacctatgtgcaaagaaaaagcattttttatcatgcagaaacggagcgc
ctgctaactataggacatccatattacccagtgtctatcggggccaaaactgttcctaag
gtctctgcaaatcagtatagggtatttaaaatacaactacctgatcccaatcaatttgca
ctacctgacaggactgttcacaacccaagtaaagagcggctggtgtggccagtcataggt
gtgcaggtgtccagagggcagcctcttggaggtactgtaactgggcaccccacttttaat
gctttgcttgatgcagaaaatgtgaatagaaaagtcaccacccaaacaacagatgacagg
aaacaaacaggcctagatgctaagcaacaacagattctgttgctaggctgtacccctgct
gaaggggaatattggacaacagcccgtccatgtgttactgatcgtctagaaaatggcgcc
tgccctcctcttgaattaaaaaacaagcacatagaagatggggatatgatggaaattggg
tttggtgcagccaacttcaaagaaattaatgcaagtaaatcagatctacctcttgacatt
caaaatgagatctgcttgtacccagactacctcaaaatggctgaggacgctgctggtaat
agcatgttcttttttgcaaggaaagaacaggtgtatgttagacacatctggaccagaggg
ggctcggagaaagaagcccctaccacagatttttatttaaagaataataaaggggatgcc
acccttaaaatacccagtgtgcattttggtagtcccagtggctcactagtctcaactgat
aatcaaatttttaatcggccctactggctattccgtgcccagggcatgaacaatggaatt
gcatggaataatttattgtttttaacagtgggggacaatacacgtggtactaatcttacc
ataagtgtagcctcagatggaaccccactaacagagtatgatagctcaaaattcaatgta
taccatagacatatggaagaatataagctagcctttatattagagctatgctctgtggaa
atcacagctcaaactgtgtcacatctgcaaggacttatgccctctgtgcttgaaaattgg
gaaataggtgtgcagcctcctacctcatcgatattagaggacacctatcgctatatagag
tctcctgcaactaaatgtgcaagcaatgtaattcctgcaaaagaagacccttatgcaggg
tttaagttttggaacatagatcttaaagaaaagctttctttggacttagatcaatttccc
ttgggaagaagatttttagcacagcaaggggcaggatgttcaactgtgagaaaacgaaga
attagccaaaaaacttccagtaagcctgcaaaaaaaaaaaaaaaataa
atggccctgtggcagcagggccagaagctgtacctgccccctacccccgtgagcaaggtg
ctttgcagtgaaacctatgtgcaaagaaaaagcattttttatcatgcagaaacggagcgc
ctgctgaccatcggacacccctattaccccgtgtccatcggggccaagactgtgcctaag
gtgtccgccaatcagtatagggtgttcaaaatccaactgcctgatcccaatcaatttgca
ctgcctgacaggaccgtgcacaaccccagcaaagagcggctggtgtggccagtgatcggc
gtgcaggtgtccagaggccagcctctgggcggcaccgtgactgggcaccccacttttaat
gctttgcttgatgcagaaaatgtgaatagaaaagtcaccacccagaccaccgacgacagg
aaacagacaggcctggatgccaagcagcagcagatcctgctgctgggctgtacccctgct
gaaggggaatattggacaacagcccgtccatgtgtgaccgaccgtctagaaaacggcgcc
tgccctcctctggagctgaaaaacaagcacatcgaagatggggatatgatggaaattggg
tttggtgcagccaacttcaaagaaattaatgcaagtaaatcagatctacctctggacatc
caaaatgagatctgcctgtaccccgactacctgaaaatggctgaggacgccgccggcaac
agcatgttcttcttcgccaggaaggagcaggtgtacgtgagacacatctggaccagaggc
ggctccgagaaagaagcccctaccacagatttttatttgaagaacaacaagggcgacgcc
accctgaagatccccagcgtgcacttcggcagccccagcggctcactagtgtccaccgac
aaccagatcttcaaccggccctactggctgttccgcgcccagggcatgaacaatggaatt
gcctggaacaacctgctgttcctgaccgtgggcgacaacacacgtggcaccaacctgacc
atcagcgtggcctccgatggaaccccactgaccgagtatgatagctcgaaattcaacgtg
taccacagacacatggaggagtataagctagccttcatcctggagctgtgctccgtggag
atcaccgcccagaccgtgtcccatctgcaaggactgatgccctccgtgctggagaattgg
gagatcggcgtgcagccccccacctcatcgatcttggaggacacctaccgctacatcgag
tcccccgccaccaagtgtgccagcaacgtgattcctgcaaaagaagacccttatgcaggg
tttaagttctggaacatcgacctgaaggagaagctgtctctggacctggatcagttcccc
ttgggcagaagatttctggcccagcagggggccggctgttccaccgtgagaaaacgcagg
atcagccagaagacctccagcaagcccgccaagaagaagaaaaagtaa
5' End
3' End
NotesSame sequence in accession NC_001522.
Expression VectorpCDNA3pcDNA3
Assay MethodsWestern Blot, Northern Blot, Southern Blot, Immunofluorescence labelingWestern Blot, Northern Blot, Southern Blot, Immunofluorescence labeling
ResultsUndetecatble.Positive.
Protein FunctionCapsid protein
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodWild-type codons replaced with synonymous codons used at relatively high
frequency by human genes
Publication Author(s)Gu, W.; Li, M.; Zhao, W. M.; Fang, N. X.; Bu, S.; Frazer, I. H.; Zhao, K. N.
Corresponding AuthorKong-Nan Zhao
Corresponding AddressCentre for Immunology and Cancer Research, University of Queensland, Princess Alexandra Hospital, Woolloongabba, Queensland 4102, Australia.
Publication Year2004
Publication TitletRNASer(CGA) differentially regulates expression of wild-type and codon-modified papillomavirus L1 genes
AbstractExogenous transfer RNAs (tRNAs) favor translation of bovine papillomavirus 1 wild-type (wt) L1 mRNA in in vitro translation systems (Zhou et al. 1999, J. Virol., 73, 4972-4982). We, therefore, investigated whether papillomavirus (PV) wt L1 protein expression could be enhanced in eukaryotic cells following exogenous tRNA supplementation. Both Chinese hamster ovary (CHO) and Cos1 cells, transfected with PV1 wt L1 genes, effectively transcribed the genes but did not translate them. However, L1 protein translation was demonstrated following co-transfection with the L1 gene and a gene expressing tRNA(Ser)(CGA). Cell lines, stably transfected with a bovine papillomavirus 1 (BPV1) wt L1 expression construct, produced L1 protein after the transfection of the tRNA(Ser)(CGA) gene, but not following the transfection with basal vectors, suggesting that tRNA(Ser)(CGA) gene enhanced wt L1 translation as a result of endogenous tRNA alterations and phosphorylation of translation initiation factors elF4E and elF2alpha in the tRNA(Ser)(CGA) transfected L1 cell lines. The tRNA(Ser)(CGA) gene expression significantly reduced translation of L1 proteins expressed from codon-modified (HB) PV L1 genes utilizing mammalian preferred codons, but had variable effects on translation of green fluorescent proteins (GFPs) expressed from six serine GFP variants. The changes of tRNA pools appear to match the codon composition of PV wt and HB L1 genes and serine GFP variants to regulate translation of their mRNAs. These findings demonstrate for the first time in eukaryotic cells that translation of the target genes can be differentially influenced by the provision of a single tRNA expression construct.
JournalNucleic Acids Res. 32(15): 4448-61.
SummaryTo determine if the expression of the tRNASer (CGA) gene construct could enhance translation of wt PV L1 mRNAs in eukaryotic cell lines, CHO cells and Cos1 cells were transfected with both PV wt L1 expression construct and codon-optimized HB PV L1 expression construct. In HB PV L1 gene, L1 ORFs are substituted with codons preferentially used in the mammalian genome. Experimental results showed that the transcriptions of both PV wt L1 and HB PV L1 were not affected by co-transfection with tRNASer (CGA) gene. However, expression of L1 protein encoded by PV wt L1 gene required co- transfection with tRNASer (CGA) gene. For codon-optimized gene, HB PV L1, tRNASer (CGA) gene resulted in a reduction in the levels of the L1 protein expression. So the hypothesis made could be approved that the matching between tRNAs and codon usage of the genes regulates expression of the cellular proteins in the cells. Futher hypothesis was made that the tRNASer (CGA) gene may favor the expression of the target genes in which UCG or other codons from the six serine codons are used more frequently. The cells were transfected solely with gene and the six serine GFP variants or co-transfected with tRNASer (CGA) gene and study the transcription and translation were study to test the hypothesis. According to the results, the hypothesis was approved.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=652
PubMed ID15319446
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site