Synthetic Gene DataBase
 

Synthetic Gene 232


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID206232
GenBank AccessionAY934878
GenBank GI60615453
Gene NameOspAsynthetic OspA (17E2)
Gene Length (bp)489492
SpeciesPiscirickettsia salmonisEscherichia coli
StrainsChile: HuenquillahueBL21 (deficient in Lon and OmpT
CDSatgaacagaggatgtttgcaaggtagtagtttaattattattagcatatttttagttggc
tgtgcccagaactttagccgtcaagaagtcggagctgcgactggggctgttgttggcggt
gttgctggccagctgtttggtaaaggcagtggtcgagttgcaatggccattggtggtgct
gttttgggtggattaattggttctaaaatcggtcaatcgatggatcagcaggataaaata
aagctaaaccagagtttagaaaaggtaaaaacagggcaagtgacacgttggcgtaatcca
gatacaggcaatagttatagtgttgaggcagtgcgtacttaccagcgttacaataagcaa
gagcgtcgccagcaatattgtcgggaatttcagcaaaaggcgatgattgcagggcagaag
caagagatttacggcactgcatgccggcaagcggatggtcgttggcaagtcatttcaaca
gaaaaataa
atgcgtggttgcctgcagggcagctctctgatcattatctctgttttcctggtgggttgc
gcccagaacttcagccgccaggaagttggcgcggccaccggtgcggttgtgggcggtgtt
gccggccagctgttcggtaaaggctctggtcgtgtggcgatggccatcggcggtgcggtt
ctgggcggtctgattggctctaaaatcggtcagagcatggaccagcaggataaaatcaaa
ctgaaccagtctctggaaaaagtgaaagccggccaggttactcgttggcgtaatccggac
accggtaacagctactctgtggaaccggttcgcacctaccagcgttacaacaaacaggaa
cgccgtcagcagtactgccgcgaatttcagcagaaagccatgatcgcaggtcagaaacag
gaaatctacggcaccgcgtgccgtcagccggatggccgctggcaggtgattagcaccgaa
aaaattaattaa
5' End
3' End
NotesAnother record in GenBank is AY934879.
Expression VectorpBC KS(+)pET21a
Assay MethodsSDS-PAGESDS-PAGE
ResultsVisible but weak expression in E. coliThe expression was not higher than those obtained with wild-type ospA. Intead, removal of signal peptide allowed substantially increased expression (13% total protein).
Protein Functionouter membrane lipoprotein; major lipoprotein antigen
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon optimized for strong expression in E. coli. The Asn-2 codon was deleted.
Publication Author(s)Kuzyk, M. A.; Burian, J.; Thornton, J. C.; Kay, W. W.
Corresponding AuthorWilliam W. Kay
Corresponding AddressCanadian Bacterial Diseases Network, Department of Biochemistry and Microbiology, University of Victoria, British Columbia.
Publication Year2001
Publication TitleOspA, a lipoprotein antigen of the obligate intracellular bacterial pathogen Piscirickettsia salmonis
AbstractNo effective recombinant vaccines are currently available for any rickettsial diseases. In this regard the first non-ribosomal DNA sequences from the obligate intracellular pathogen Piscirickettsia salmonis are presented. Genomic DNA isolated from Percoll density gradient purified P. salmonis, was used to construct an expression library in lambda ZAP II. In the absence of preexisting DNA sequence, rabbit polyclonal antiserum raised against P. salmonis, with a bias toward P. salmonis surface antigens, was used to identify immunoreactive clones. Catabolite repression of the lac promoter was required to obtain a stable clone of a 4,983 bp insert in Escherichia coli due to insert toxicity exerted by the accompanying radA open reading frame (ORF). DNA sequence analysis of the insert revealed 1 partial and 4 intact predicted ORF's. A 486 bp ORF, ospA, encoded a 17 kDa antigenic outer surface protein (OspA) with 62% amino acid sequence homology to the genus common 17 kDa outer membrane lipoprotein of Rickettsia prowazekii, previously thought confined to members of the genus Rickettsia. Palmitate incorporation demonstrated that OspA is posttranslationally lipidated in E. coli, albeit poorly expressed as a lipoprotein even after replacement of the signal sequence with the signal sequence from lpp (Braun lipoprotein) or the rickettsial 17 kDa homologue. To enhance expression, ospA was optimized for codon usage in E. coli by PCR synthesis. Expression of ospA was ultimately improved (approximately 13% of total protein) with a truncated variant lacking a signal sequence. High level expression (approximately 42% tot. prot.) was attained as an N-terminal fusion protein with the fusion product recovered as inclusion bodies in E. coli BL21. Expression of OspA in P. salmonis was confirmed by immunoblot analysis using polyclonal antibodies generated against a synthetic peptide of OspA (110-129) and a strong antibody response against OspA was detected in convalescent sera from coho salmon (Oncorhynchus kisutch).
JournalJ Mol Microbiol Biotechnol. 3(1): 83-93.
SummaryThe P. salmonis ospA gene was codon optimized for expression in E. coli but the expression was not significantly higher. Instead, removal of the signal peptide dramatically increased the protein production.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=597
PubMed ID11200233
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site