Synthetic Gene DataBase
 

Synthetic Gene 233


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID207233
GenBank Accession
GenBank GI
Gene Namewtgagsyngag
Gene Length (bp)15391539
SpeciesHIV-1African green monkey; Homo sapiens; Mus musculus
StrainsCOS-7; H1299; BALB/c
CDSatgggcgccagggccagcgtgctgagcggcggcgagctggacaggtgggagaagatcagg
ctgaggcccggcggcaagaagaagtataagctgaagcacatcgtgtgggccagcagggag
ctggagaggttcgccgtgaaccccggcctgctggagaccagcgagggctgcaggcagatc
ctgggccagctgcagcccagcctgcagaccggcagcgaggagctgaggagcctgtacaac
accgtggccaccctgtactgcgtgcaccagaggatcgagatcaaggacaccaaggaggcc
ctggacaagatcgaggaggagcagaacaagtccaagaagaaggcccagcaggccgccgcc
gacaccggccacagcagccaggtgagccagaactaccccatcgtgcagaacatccagggc
cagatggtgcaccaggccatcagccccaggaccctgaacgcctgggtgaaggtggtggag
gagaaggccttcagccccgaggtgatccccatgttcagcgccctgagcgagggagccacc
ccccaggacctgaacaccatgctgaacaccgtgggcggccaccaggccgccatgcagatg
ctgaaggagaccatcaacgaggaggccgccgagtgggacagggtgcaccccgtgcacgcc
ggccccatcgcccccggccagatgagggagccccgcggcagcgacatcgccggcaccacc
agcaccctgcaggagcagatcggctggatgaccaacaacccccccatccccgtgggcgaa
atctacaagaggtggatcatcctgggcctgaacaagatcgtgaggatgtacagccccacc
agcatcctggatatcaggcagggccccaaagagcccttcagggactacgtggacaggttc
tacaagaccctgcgcgccgagcaggccagccaggaggtgaagaactggatgaccgagacc
ctgctggtgcagaacgccaaccccgactgcaagaccatcctgaaggccctgggacccgcc
gccaccctggaggagatgatgaccgcctgccagggcgtgggcggccccggccacaaggcc
agggtgctggccgaggccatgagccaggtgaccaacaccgccaccatcatgatgcagagg
ggcaacttcaggaaccagaggaagatggtgaagtgcttcaactgcggcaaggagggccac
accgccaggaactgccgcgcccccaggaagaagggctgctggaagtgcggcaaggagggc
caccagatgaaggactgcaccgagaggcaggccaacttcctgggcaagatctggcccagc
tacaagggcaggcccggcaacttcctgcagagcaggcccgagcccaccgccccccccttc
ctgcagagcaggcccgagcccaccgccccccccgaggagagcttcaggagcggcgtggag
accaccacccccccccagaagcaggagcccatcgacaaggagctgtaccccctgaccagc
ctgaggagcctgttcggcaacgacccctcgtcacaataa
atgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcagtcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtaatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtacatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggacaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaagaaccttttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaatacagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagatggttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
tacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccattt
cttcagagcagaccagagccaacagccccaccagaagagagcttcaggtctggggtagag
acaacaactccccctcagaagcaggagccgatagacaaggaactgtatcctttaacttcc
ctcagatcactctttggcaacgaccccagcagccagtga
5' Endgcgggtaccgaattcaggagagagatgggtgcgagagcgtcagtattaagcgcgggtaccgaattcaggagagagatgggtgcgagagcgtcagtattaagc
3' Endctctttggcaacgacccctcgtcacaataaggatccctcgaggagctcggcctctttggcaacgacccctcgtcacaataaggatccctcgaggagctcggc
Noteswtgag CAI = 0.69, coding sequence obtained by OCR from image at http://jvi.asm.org/cgi/content/full/74/22/10822syngag CAI = 0.99, coding sequence obtained by OCR from image at http://jvi.asm.org/cgi/content/full/74/22/10822
Expression VectorpcDNA3.1pcDNA3.1
Assay MethodsWestern Blot, Northern Blot, ELISAWestern Blot, Northern Blot, ELISA
Resultslittle protein product, no immune response in micerecoded gene was expressed several orders of magnitude more product than the wild-type gene and vaccinated mice showed a much strong immune response against Pr55gag. GC content increased from 44.1% (wt) to 62.7% (syn)
Protein FunctionPr55gag polyprotein comprises the viral capsid, nucleic capsid, and matrix protein.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding Methodremoved splice sites, polyA tail site and instability elements and humanized the gene sequence.
Publication Author(s)Graf, M.; Deml, L.; Wagner, R.
Corresponding Author
Corresponding AddressGeneart, Regensburg, Germany.
Publication Year2004
Publication TitleCodon-optimized genes that enable increased heterologous expression in mammalian cells and elicit efficient immune responses in mice after vaccination of naked DNA
AbstractMany of the problems related with mammalian gene expression, such as low translation efficiency and mRNA halflife, can be solved by means of a rational gene design, based on modern bioinformatics, followed by the de novo generation of a synthetic gene. Moreover, high expression rates and prolonged mRNA stability are not only crucial for heterologous mammalian expression, but, in particular, are important for the generation of effective DNA vaccines. In this chapter we show that an optimized synthetic gene encoding the HIV-1 Pr55gag outperforms wild-type gene driven expression by several orders of magnitude. RNA analysis revealed that this positive effect was mostly due to increased mRNA stability of the optimized transcripts. Moreover, mice vaccinated with the optimized gag gene elicited a much stronger immune response against Pr55gag than the control groups immunized with the respective wild-type gene.
JournalMethods Mol Med. 94(): 197-210.
SummaryProblems with heterologous gene expression of an HIV gene like low translation efficiency and mRNA half-life were addressed by the authors with gene recoding. The gene of interest was the HIV-1 gag gene which codes for the Pr55gag polyprotein. The authors wished to generate a DNA vaccine more effective than a typical protein vaccine. The authors hypothesized there would be very difficult for mammalian cells to express the wild-type gene and ultimately produce antibodies. Genes like gag employ several expression inhibiting elements including the use of splice sites, polyA tail site, and instability elements. The authors removed these elements and also recoded the gene to mammalianize it and remove all rare codons. The CAI of the wild-type gene was raised from 0.69 to 0.99 upon recoding. Assays show syngag expression levels to be consistently and drastically higher than of wtgag. Also, immunized mice showed both Th1 and Th2 immune response.
CommentsNo corresponding author nor email given.
Discussion
PubMed ID14959831
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site