Synthetic Gene DataBase
 

Synthetic Gene 234


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID209234
GenBank AccessionAY588945
GenBank GI55792399
Gene NameSIVmac239 GagtPA-Gag(LLO)
Gene Length (bp)15331
SpeciesSIVMus musculus; Homo sapiens
StrainsSIVmac239BALB/c; HeLa
CDSatgggcgtgagaaactccgtcttgtcagggaagaaagcagatgaattagaaaaaattagg
ctacgacccaacggaaagaaaaagtacatgttgaagcatgtagtatgggcagcaaatgaa
ttagatagatttggattagcagaaagcctgttggagaacaaagaaggatgtcaaaaaata
ctttcggtcttagctccattagtgccaacaggctcagaaaatttaaaaagcctttataat
actgtctgcgtcatctggtgcattcacgcagaagagaaagtgaaacacactgaggaagca
aaacagatagtgcagagacacctagtggtggaaacaggaacaacagaaactatgccaaaa
acaagtagaccaacagcaccatctagcggcagaggaggaaattacccagtacaacaaata
ggtggtaactatgtccacctgccattaagcccgagaacattaaatgcctgggtaaaattg
atagaggaaaagaaatttggagcagaagtagtgccaggatttcaggcactgtcagaaggt
tgcaccccctatgacattaatcagatgttaaattgtgtgggagaccatcaagcggctatg
cagattatcagagatattataaacgaggaggctgcagattgggacttgcagcacccacaa
ccagctccacaacaaggacaacttagggagccgtcaggatcagatattgcaggaacaact
agttcagtagatgaacaaatccagtggatgtacagacaacagaaccccataccagtaggc
aacatttacaggagatggatccaactggggttgcaaaaatgtgtcagaatgtataaccca
acaaacattctagatgtaaaacaagggccaaaagagccatttcagagctatgtagacagg
ttctacaaaagtttaagagcagaacagacagatgcagcagtaaagaattggatgactcaa
acactgctgattcaaaatgctaacccagattgcaagctagtgctgaaggggctgggtgtg
aatcccaccctagaagaaatgctgacggcttgtcaaggagtaggggggccgggacagaag
gctagattaatggcagaagccctgaaagaggccctcgcaccagtgccaatcccttttgca
gcagcccaacagaggggaccaagaaagccaattaagtgttggaattgtgggaaagaggga
cactctgcaaggcaatgcagagccccaagaagacagggatgctggaaatgtggaaaaatg
gaccatgttatggccaaatgcccagacagacaggcgggttttttaggccttggtccatgg
ggaaagaagccccgcaatttccccatggctcaagtgcatcaggggctgatgccaactgct
cccccagaggacccagctgtggatctgctaaagaactacatgcagttgggcaagcagcag
agagaaaagcagagagaaagcagagagaagccttacaaggaggtgacagaggatttgctg
cacctcaattctctctttggaggagaccagtag
5' End
3' End
NotesEmailed corresponding author for coding sequence(s) 2/7/2006.
Expression VectorpCAGGSpCAGGS
Assay Methodsflow cytometry, immune response, ELISA
ResultsNo vaccine synthesized from wild-type genes; hence, no experimental results.All recoded genes synthesized protein products at high levels and secreted products from cell as should be the case for these particular proteins. Immune response assays showed Gag/LLO immune response was an improvement over Gag but that tPA/Gag/LLO was m
Protein Functioncapsid protein
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodA synthetic gene for SIVmac239 Gag protein with codons optimized for mammalian usage was synthesized
by PCR assembly of long single strand DNA templates as described by Haas et. al (1996).
Publication Author(s)Ye, L.; Bu, Z.; Skeen, M. J.; Ziegler, H. K.; Compans, R. W.; Yang, C.
Corresponding AuthorChinglai Yang
Corresponding AddressDepartment of Microbiology & Immunology, Rollins Research Center, Emory University School of Medicine, Room 3086, 1510 Clifton Road, Atlanta, GA 30322, USA.
Publication Year2003
Publication TitleEnhanced immunogenicity of SIV Gag DNA vaccines encoding chimeric proteins containing a C-terminal segment of Listeriolysin O
AbstractWe investigated the potential of the C-terminal 59-amino acid segment of Listeriolysin O (LLO) in enhancing immune responses against the SIV Gag antigen in the context of DNA immunization. Genes with codons optimized for mammalian expression were synthesized for the SIVmac239 Gag, a secreted SIV Gag protein with the tissue plasminogen antigen (tPA) signal fused to its N-terminus (tPA/Gag), as well as their corresponding chimeric proteins Gag/LLO and tPA/Gag/LLO containing the C-terminal 59 amino acids of LLO. Analysis of immune responses to these DNA constructs in a Balb/c mouse model showed that the Gag/LLO construct induced higher levels of both CD4 and CD8 T cell responses against SIV Gag, whereas the tPA/Gag construct induced higher levels of CD4 T cell responses. Moreover, immunization with the tPA/Gag/LLO construct further enhanced both CD4 and CD8 T cell responses. DNA constructs encoding secreted Gag proteins (tPA/Gag and tPA/Gag/LLO) were also more effective in eliciting antibody responses against SIV Gag. Our results demonstrate that the C-terminal segment of LLO can be effectively employed to enhance both cellular and humoral immune responses in the context of a DNA vaccine.
JournalVirus Res. 97(1): 16-Jul.
SummaryThe authors wished to generate an SIV vaccine using a combination of DNA sequences from different antigens. The SIV Gag gene was the main gene, and it appeared in each plasmid constructed. Gag/LLO contained Gag and then C-terminal 59 aa segment of the LLO from L. monocytogenes. tPA/Gag contained a portion of tissue plasminogen antigen in front of Gag. tPA/Gag/LLO had all three genes incorporated into one plasmid. The authors believed these additional antigen coding segments could induce higher immune response as previous studies have shown. Transfection of HeLa cells showed all four recoded constructs were capable of efficiently synthesizing their respective gene products and secrete them from cells. Immune response assays showed Gag/LLO immune response was an improvement over Gag but that tPA/Gag/LLO was most effective. Thus, the authors showed that the combined antigen design strategy was successful in producing an increasingly effective immune response.
CommentsNo vaccine synthesized from wild-type genes.
Discussion
PubMed ID14550583
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site