Synthetic Gene DataBase
 

Synthetic Gene 235


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID210235
GenBank Accession
GenBank GI
Gene NamehIL-18hIL-18opti
Gene Length (bp)471471
SpeciesHomo sapiensE. coli
StrainsBL-21 (DE3)
CDStactttggcaagcttgaatctaaattatcagtcataagaaatttgaatgaccaagttctc
ttcattgaccaaggaaatcggcctctatttgaagatatgactgattctgactgtagagat
aatgcaccccggaccatatttattataagtatgtataaagatagccagcctagaggtatg
gctgtaactatctctgtgaactgtgagaaaatttcaactctctcctgtgagaacaaaatt
atttcctttaacgaaatgaatcctcctgataacatcaaggatacaaaaagtgacatcata
ttctttcagagaagtgtcccaggacatgataataagatgcaatttgaatcttcatcatac
gaaggatactttctagcttgtgaaaaagacagagacctttttaaactcattttgaaaaaa
gaggatgaattgggggatagatctataatgttcactgttcaaaacgaagac
tacttcggtaaactggaatctaacctgtccgttatccgtaacctgaatgaccaggtactg
tttattgatcaagccaaccgcccgctgttcgaggacatgaccgatagcgactgccgtgat
aacgctccacgcactatctttattatctctatgtataaagactcccagcctcgtggtatg
gcagtgacgattagcgtcaactgtgaaaaaatctctaccctgtcctgcgaaaacaagatt
atcagcttcaaagagatgaacccgccggataacattaaagacactaaatctgatatcatc
tttttccagcgctccgttccgggccacgacaacaaaatgcagttcgaaagctcttcctac
gaaggttacttcctggcgtgtgaaaaagaacgtgatctgttcaaactgatcctgaaaaaa
gaagacgaactgggcgatcgttctatcatgttcaccgttcagaacgaagac
5' End
3' End
NotesCoding sequence obtained using OCR. Expect errors.Coding sequence obtained using OCR. Expect errors.
Expression VectorpGEX-4T-1pGEX-4T-Xa-hIL-18opti
Assay MethodsSDS-PAGE, JIMRO, NMRSDS-PAGE, JIMRO, NMR
ResultsYielded 0.8-0.9 mg protein per liter culture5x more protein than wild-type sequence, yielded 0.8-0.9 mg protein per liter culture, proteins was able to induced almost the same level of IFN-gamma indicating correct protein folding and activity.
Protein FunctionIFN-gamma inducing factor
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe recoded gene replaced all rare codons occurring at frequency of 10% or less within E. coli with
more widely used codons. Also, less drastic changes were made to made to codons with frequencies
slightly above 10%.
Publication Author(s)Li, A.; Kato, Z.; Ohnishi, H.; Hashimoto, K.; Matsukuma, E.; Omoya, K.; Yamamoto, Y.; Kondo, N.
Corresponding AuthorZenichiro Kato
Corresponding AddressDepartment of Pediatrics, Gifu University School of Medicine, Tsukasa 40, Gifu 500-8705, Japan.
Publication Year2003
Publication TitleOptimized gene synthesis and high expression of human interleukin-18
AbstractHuman interleukin-18 (hIL-18), originally known as an IFN-gamma-inducing factor, is a recently cloned cytokine that is secreted by Kupffer cells of the liver and by stimulated macrophages. We have previously established a method of expression and purification of IL-18. The yield however remains low and the insufficient expression of a heterologous protein could be due to skewed codon usage between the expression host and the cDNA donor. The sequence of mature hIL-18 has 37 a.a. rare codons for Escherichia coli in a total of 157 a.a. To overcome this problem, gene synthesis was performed with optimized codons for the expression host E. coli. The final yield of the hIL-18 protein with optimized codons was about five times higher than the yield with the native sequence. Using a minimal medium, this system produces large quantities of labeled proteins that can be used in NMR analysis. Our simple and efficient production system can be applied to the production of other cytokines for new structural and therapeutic use.
JournalProtein Expr Purif. 32(1): 110-8.
SummaryThe authors were interested synthesizing high levels of human interleuking-18 (hIL-18), which is capable of inducing IFN-gamma in immune response. They were able to improve hIL-18 expression by using a recoding gene, which replaced every rare codons (codon frequency <10%) with more abundant codons. Some low frequency codons were also replaced. Overall, the recoded gene yielded 5x more protein in the same volume of culture. Further analysis showed synthesized hIL-18 was able to induce similar levels of IFN-gamma as hIL-18 produced in vivo.
Comments
Discussion
PubMed ID14680947
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site