Synthetic Gene DataBase
 

Synthetic Gene 236


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID211236
GenBank AccessionY13047
GenBank GI2597923
Gene NamehGSTA4recombinant hGST A4-4
Gene Length (bp)669669
SpeciesHomo sapiensEscherichia coli
StrainsJM109
CDSatggcagcaaggcccaagctccactatcccaacggaagaggccggatggagtccgtgaga
tgggttttagctgccgccggagtcgagtttgatgaagaatttctggaaacaaaagaacag
ttgtacaagttgcaggatggtaaccacctgctgttccaacaagtgcccatggttgaaatt
gacgggatgaagttggtacagacccgaagcattctccactacatagcagacaagcacaat
ctctttggcaagaacctcaaggagagaaccctgattgacatgtacgtggaggggacactg
gatctgctggaactgcttatcatgcatcctttcttaaaaccagatgatcagcaaaaggaa
gtggttaacatggcccagaaggctataattagatactttcctgtgtttgaaaagatttta
aggggtcacggacaaagctttcttgttggtaatcagctgagccttgcagatgtgatttta
ctccaaaccattttagctctagaagagaaaattcctaatatcctgtctgcatttcctttc
ctccaggaatacacagtgaaactaagtaatatccctacaattaagagattccttgaacct
ggcagcaagaagaagcctccccctgatgaaatttatgtgagaaccgtctacaacatcttt
aggccataa
atggcggcgaggccaaagcttcactatccgaatggaaggggtcgcatggagtccgtgaga
tgggttttagctgccgccggagtcgagtttgatgaagaatttctggaaacaaaagaacag
ttgtacaagttgcaggatggtaaccacctgctgttccaacaagtgcccatggttgaaatt
gacgggatgaagttggtacagacccgaagcattctccactacatagcagacaagcacaat
ctctttggcaagaacctcaaggagagaaccctgattgacatgtacgtggaggggacactg
gatctgctggaactgcttatcatgcatcctttcttaaaaccagatgatcagcaaaaggaa
gtggttaacatggcccagaaggctataattagatactttcctgtgtttgaaaagatttta
aggggtcacggacaaagctttcttgttggtaatcagctgagccttgcagatgtgatttta
ctccaaaccattttagctctagaagagaaaattcctaatatcctgtctgcatttcctttc
ctccaggaatacacagtgaaactaagtaatatccctacaattaagagattccttgaacct
ggcagcaagaagaagcctccccctgatgaaatttatgtgagaaccgtctacaacatcttt
aggccataa
5' End
3' End
NotesNote: two E. coli rare codon AGG are still present in the first 15 codons.
Expression VectorNApKK-D
Assay MethodsNA
ResultsNot determined40mg of purified protein in 3 liters of bacterial culture.
Protein FunctionGlutathione transferase
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe first 15 codons was optimized by randomizing silent positions (refers to Widersten et al. 1996).
Publication Author(s)Hubatsch, I.; Ridderstrom, M.; Mannervik, B.
Corresponding AuthorBengt Mannervik
Corresponding AddressDepartment of Biochemistry, Uppsala University, Biomedical Center, Box 576, S-751 23 Uppsala, Sweden.
Publication Year1998
Publication TitleHuman glutathione transferase A4-4: an alpha class enzyme with high catalytic efficiency in the conjugation of 4-hydroxynonenal and other genotoxic products of lipid peroxidation
AbstractA sequence encoding a novel glutathione transferase, GST A4-4, has been identified in a human fetal brain cDNA library. The protein has been produced in Escherichia coli after optimization of the codon usage for high-level heterologous expression. The dimeric protein has a subunit molecular mass of 25704 Da based on the deduced amino acid composition. Human GST A4-4 is a member of the Alpha class but shows only 53% amino acid sequence identity with the major liver enzyme GST A1-1. High catalytic efficiency with 4-hydroxyalkenals and other cytotoxic and mutagenic products of radical reactions and lipid peroxidation is a significant feature of GST A4-4. The kcat/Km values for 4-hydroxynonenal and 4-hydroxydecenal are > 3 x 10(6) M-1. s-1, several orders of magnitude higher than the values for conventional GST substrates. 4-Hydroxynonenal and other reactive electrophiles produced by oxidative metabolism have been linked to aging, atherosclerosis, cataract formation, Parkinson's disease and Alzheimer's disease, as well as other degenerative human conditions, suggesting that human GST A4-4 fulfills an important protective role and that variations in its expression may have significant pathophysiological consequences.
JournalBiochem J. 330(1): 175-9.
SummaryA new human gene: GST A4 was characterized in this study. The first 15 codons were codon optimized for expression in E. coli. Because there was no expression data on the wild-type gene in E. coli, it is uncertain whether the codon optimization increased or decreased the protein expression level.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=609
PubMed ID9461507
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site