Synthetic Gene DataBase
 

Synthetic Gene 237


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID212237
GenBank AccessionM63509
GenBank GI183300
Gene NameGSTM2pKHXhGM2
Gene Length (bp)657657
SpeciesHomo sapiensEscherichia coli
StrainsXL1-Blue
CDSatgcccatgacactggggtactggaacatccgcgggctggcccattccatccgcctgctc
ctggaatacacagactcaagctacgaggaaaagaagtacacgatgggggacgctcctgat
tatgacagaagccagtggctgaatgaaaaattcaagctgggcctggactttcccaatctg
ccctacttgattgatgggactcacaagatcacccagagcaatgccatcctgcggtacatt
gcccgcaagcacaacctgtgcggggaatcagaaaaggagcagattcgcgaagacattttg
gagaaccagtttatggacagccgtatgcagctggccaaactctgctatgacccagatttt
gagaaactgaaaccagaatacctgcaggcactccctgaaatgctgaagctctactcacag
tttctggggaagcagccatggtttcttggggacaagatcacctttgtggatttcatcgct
tatgatgtccttgagagaaaccaagtatttgagcccagctgcctggatgccttcccaaac
ctgaaggacttcatctcccgatttgagggcttggagaagatctctgcctacatgaagtcc
agccgcttcctcccaagacctgtgttcacaaagatggctgtctggggcaacaagtag
atgcctatgacccttggttactggaacatccgcggtctcgcgcattccatccgcctgctc
ctggaatacacagactcaagctacgaggaaaagaagtacacgatgggggacgctcctgat
tatgacagaagccagtggctgaatgaaaaattcaagctgggcctggactttcccaatctg
ccctacttgattgatgggactcacaagatcacccagagcaatgccatcctgcggtacatt
gcccgcaagcacaacctgtgcggggaatcagaaaaggagcagattcgcgaagacattttg
gagaaccagtttatggacagccgtatgcagctggccaaactctgctatgacccagatttt
gagaaactgaaaccagaatacctgcaggcactccctgaaatgctgaagctctactcacag
tttctggggaagcagccatggtttcttggggacaagatcacctttgtggatttcatcgct
tatgatgtccttgagagaaaccaagtatttgagcccagctgcctggatgccttcccaaac
ctgaaggacttcatctcccgatttgagggcttggagaagatctctgcctacatgaagtcc
agccgcttcctcccaagacctgtgttcacaaagatggctgtctggggcaacaagtaa
5' Endaggagagagaattc
3' Endtgagtcgacctcctc
NotesThe expression level was estimated by the enzyme activity
Expression VectorpKK-DpKK
Assay MethodsLysate activity assayLysate activity assay
ResultsLow expressionThe expression improved ~140 fold compared with wild-type. It generated 190mg protein/liter of bacterial culture.
Protein Functionglutathione S-transferase
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodDegenerate primers were used in the 5' to introduce random mutations in silent position in codons 2,
4-7, and 10-14. Wild-type codon was replaced with two sequential stop codons TAATGA
Publication Author(s)Johansson, A. S.; Bolton-Grob, R.; Mannervik, B.
Corresponding AuthorBengt Mannervik
Corresponding AddressDepartment of Biochemistry, Biomedical Center, Uppsala University, Uppsala, S-751 23, Sweden.
Publication Year1999
Publication TitleUse of silent mutations in cDNA encoding human glutathione transferase M2-2 for optimized expression in Escherichia coli
AbstractHeterologous expression of human glutathione transferase M2-2 (GST M2-2) using Escherichia coli was improved 140-fold by mutating the cDNA expressing the enzyme. Expression of GST M2-2 from this cDNA clone, pKHXhGM2, generated approximately 190 mg protein per liter of bacterial culture, corresponding to approximately 12% of the total amount of soluble protein. The high-level-expressing cDNA was generated by oligonucleotide-directed mutagenesis introducing alternative silent mutations into the third nucleotide of codons 2, 4-7, and 10-14 in the 5' end of the cDNA coding region. The choice of alternative codons was restricted to those naturally occurring in highly biased genes in E. coli. Furthermore, the wild-type TAG stop codon at the 3' end was replaced with the two stop codons TAA and TGA in tandem to increase translation termination efficiency. The resulting partially randomized cDNA library was assayed for high-level expression using immunoscreening. Sequence similarities between the constructed high-level-expressing GST M2-2 cDNA and a similarly designed cDNA encoding the closely related human GST M1-1 suggest that the codons in the region immediately following the start codon are influential in achieving high-level expression. Pyrimidines seem to be more favorable than purines in the third position of codons in optimizing the expression of these enzymes in E. coli.
JournalProtein Expr Purif. 17(1): 105-12.
SummaryAn interesting strategy was used in study to explore the effects of codon optimization at the 5' on the protein expression level. Degenerate primers were designed to introduce silent mutations at the codons 2, 4-7 and 10-14. Among 1600 clones, immunoscreening identified 20 clones of high expression. Analysis of the nucleotide sequence of the most highly expressed clone revealed that E. coli preferred codons were used.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=610
PubMed ID10497075
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site