Synthetic Gene DataBase
 

Synthetic Gene 238


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID213238
GenBank AccessionNM_000515
GenBank GI20809248
Gene Namegrowth hormone 1 (gh1)hGH1
Gene Length (bp)654654
SpeciesHomo sapiensEscherichia coli
StrainsHB101
CDSatggctacaggctcccggacgtccctgctcctggcttttggcctgctctgcctgccctgg
cttcaagagggcagtgccttcccaaccattcccttatccaggctttttgacaacgctatg
ctccgcgcccatcgtctgcaccagctggcctttgacacctaccaggagtttgaagaagcc
tatatcccaaaggaacagaagtattcattcctgcagaacccccagacctccctctgtttc
tcagagtctattccgacaccctccaacagggaggaaacacaacagaaatccaacctagag
ctgctccgcatctccctgctgctcatccagtcgtggctggagcccgtgcagttcctcagg
agtgtcttcgccaacagcctggtgtacggcgcctctgacagcaacgtctatgacctccta
aaggacctagaggaaggcatccaaacgctgatggggaggctggaagatggcagcccccgg
actgggcagatcttcaagcagacctacagcaagttcgacacaaactcacacaacgatgac
gcactactcaagaactacgggctgctctactgcttcaggaaggacatggacaaggtcgag
acattcctgcgcatcgtgcagtgccgctctgtggagggcagctgtggcttctag
atgttcccaactattccactgagtcgcctgttcgataacgcgatgctgcgtgcgcatcgt
ctgcaccaactggctttcgacacttaccaggagttcgaagaagcatacatcccgaaagaa
cagaaatacagcttccttcagaacccacagacctcgttgtgtttctctgaaagtatcccg
accccttctaaccgcgaagagacccagcagaaatcgaaccttgaactgcttcgtatctcg
ctgcttctcattcagtcgtggctggagccagtacagttcctgcgttcggttttcgcaaac
tcactggtttacggtgcgtctgacagtaacgtttacgacctgctgaaagaccttgaagaa
gggatccagaccctgatgggtcgcctggaagatggttcaccacgcactggtcagatcttc
aaacagacttactccaaattcgatactaactctcataacgatgatgctctgctgaaaaac
tacggcctgctgtactgtttccgtaaagatatggataaagttgaaactttcctgcgtatc
gttcagtgtcgttctgttgaagggtcgtgtggcttctaa
5' End
3' End
NotesNo information on the wild-type gene was given in the paper so the NM_000515 in GenBank was used for referenceThe distance between SD and ATG did not show significant effect among the four constructs tested.
Expression VectorNApCT-1
Assay MethodsNARadioimmunoassay
ResultsExpression not determined.The yield was estimated to be 169 ug/ml of culture medium or 2.9E6 molecules per cell.
Protein FunctionGrowth hormone
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe codon usage was replaced with the preferred codons found in E. coli. tufA gene that encodes for
elongation factor Tu (Yokota et al 1980). A SD sequence was added 8, 9, 11 or 13 bp upstream of ATG
Publication Author(s)Ikehara M, Ohtsuka E, Tokunaga T, Taniyama Y, Iwai S, Kitano K, Miyamoto S, Ohgi T, Sakuragawa Y, Fujiyama K, et al.
Corresponding AuthorM. Ikehara
Corresponding AddressInstitute for Molecular and Cellular Biology, Osaka University, Osaka 530, Japan
Publication Year1984
Publication TitleSynthesis of a gene for human growth hormone and its expression in Escherichia coli.
AbstractA gene coding for human growth hormone, which consists of 192 amino acids, was chemically synthesized. The synthesis entailed ligating 78 deoxyribooligonucleotides, which had been synthesized on polymer supports by the phosphotriester method with frequently occurring amino acid codons of Escherichia coli. The chemically synthesized gene was inserted into an E. coli plasmid downstream from the E. coli trp promoter, with a modified ribosome-binding region carried on pBR322. E. coli cells transformed with this recombinant plasmid synthesized 2.9 X 10(6) molecules per cell of human growth hormone upon induction. The induced polypeptide was identical with natural human growth hormone in size and in immunological properties, as well as in biological activity as examined by the tibial test with hypophysectomized rats.
JournalProc Natl Acad Sci U S A.. 81(19): 5956-60..
SummaryThe human growth hormone 1 gene was codon optimized for expression in E. coli with reference to the codon preference in tufA gene. The synthetic gene led to high yield of protein. At the time it was published, the synthetic gene was the longest gene chemically constructed.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=611
PubMed ID6091124
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site