Synthetic Gene DataBase
 

Synthetic Gene 239


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID214239
GenBank AccessionBD086203
GenBank GI22631813
Gene NameProDer p 1/DNA ProDer p 1recProDer p 1
Gene Length (bp)909909
SpeciesDermatophagoides pteronyssinusMus musculus; African Green Monkey
StrainsCBA/J; COS-7
CDScgtccatcatcgatcaaaacttttgaagaatacaaaaaagccttcaacaaaagttatgct
accttcgaagatgaagaagctgcccgtaaaaactttttggaatcagtaaaatatgttcaa
tcaaatggaggtgccatcaaccatttgtccgatttgtcgttggatgaattcaaaaaccga
tttttgatgagtgcagaagcttttgaacacctcaaaactcaattcgatttgaatgctgaa
actaacgcctgcagtatcaatggaaatgctccagctgaaatcgatttgcgacaaatgcga
actgtcactcccattcgtatgcaaggaggctgtggttcatgttgggctttctctggtgtt
gccgcaactgaatcagcttatttggcttaccgtaatcaatcattggatcttgctgaacaa
gaattagtcgattgtgcttcccaacacggttgtcatggtgataccattccacgtggtatt
gaatacatccaacataatggtgtcgtccaagaaagctactatcgatacgttgcacgagaa
caatcatgccgacgaccaaatgcacaacgtttcggtatctcaaactattgccaaatttac
ccaccaaatgtaaacaaaattcgtgaagctttggctcaaacccacagcgctattgccgtc
attattggcatcaaagatttagacgcattccgtcattatgatggccgaacaatcattcaa
cgcgataatggttaccaaccaaactatcacgctgtcaacattgttggttacagtaacgca
caaggtgtcgattattggatcgtacgaaacagttgggataccaattggggtgataatggt
tacggttattttgctgccaacatcgatttgatgatgattgaagaatatccatatgttgtc
attctctaa
cggccgagctccattaagaccttcgaggaatacaagaaagccttcaacaagagctatgcc
accttcgaggacgaggaggccgcgcgcaagaacttcctggaaagcgtgaaatacctgcag
agcaacggcggggctataaatcacctgtccgacctgtctttagacgagttcaagaaccgg
ttcctgatgagcgccgaggctttcgaacaccttaagacccagtttgatctcaacgcggag
accaacgcctgcagtatcaacggcaatgcccccgctgagattgatctgcgccagatgagg
accgtgactcccatccgcatgcaaggcggctgcgggtcttgttgggccttttcaggcgtg
gccgcgacagagtcggcatacctcgcgtatcggaatcagagcctggacctcgctgagcag
gagctcgttgactgcgcctcccaacacggatgtcatggggatacgattcccagacctatc
gaatacatccagcataatggcgtcgtgcaggaaagctattaccgatacgtagctagggag
cagtcctgccgccgtcctaacgcacagcgcttcggcatttccaattattgccagatctac
ccccctaatgccaacaagatcagggaggccctggcgcagacgcacagcgccatcgctgtc
atcatcggaatcaaggatctggacgcattccggcactatgacgggcgcacaatcatccag
cgcgacaacggatctcagccaaactaccacgcggtcaacatcgtgggttcatcgaacgcc
cagggggtggactactggatcgtgagaaacagttgggacactaactggggcgacaacggc
tacggctacttcgccgccaacatcgacctgatgatgatcgaggagtacccgtacgtggtg
atcctgtaa
5' End
3' End
NotesSequence taken from previous paper Massaer 2001.Sequence taken from previous paper Massaer 2001.
Expression VectorpJW4304pNIV4868
Assay MethodsELISA, Bronchoalveolar lavage cell countELISA, Bronchoalveolar lavage cell count
ResultsMice were exposed to the gene by injection of DNA on the pJW4304 plasmid and naked DNA. Naked DNA caused a weaker allergic response in mice to the purified allergen challenge. Cells showed production of anti-ProDer p 1 IgG2a, IgG1, and no IgE antibody. TTransient transfection in COS-7 cells showed the allergen was expressed and correctly folded. In vivo, recProDer p 1 induced intermediate IgE ODs compared to the two wild-type’s levels.
Protein Functionmajor mite allergen precursor
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodSynthetic gene encoding ProDer p 1 was recoded on the basis of the codon usage frequently found in
highly expressed human genes.
Publication Author(s)Jacquet, A.; Magi, M.; Haumont, M.; Jurado, M.; Garcia, L.; Bollen, A.
Corresponding AuthorAlain Jacquet
Corresponding AddressService de Genetique Appliquee, Universite Libre de Bruxelles, Institut de Biologie et de Medecine Moleculaires, Gosselies, Belgium. alain.jacquet@ulb.ac.be
Publication Year2003
Publication TitleAbsence of immunoglobulin E synthesis and airway eosinophilia by vaccination with plasmid DNA encoding ProDer p 1
AbstractBACKGROUND: Various studies have shown that immunization with naked DNA encoding allergens induces T helper 1(Th1)-biased non-allergic responses. OBJECTIVE: To evaluate the polarization of the immune responses induced by vaccinations with plasmid DNA encoding the major mite allergen precursor ProDer p 1. METHODS: A DNA vaccine was constructed on the basis of a synthetic cDNA encoding ProDer p 1 with optimized codon usage. The immunogenicity of ProDer p 1 DNA in CBA/J mice was compared with that of purified natural Der p 1 or recombinant ProDer p 1 adjuvanted with alum. Vaccinated mice were subsequently exposed to aerosolized house dust mite extracts to provoke airway inflammation. The presence of inflammatory cells was examined in bronchoalveolar lavage (BAL) fluids and allergen-specific T cell reactivity was measured. RESULTS: Naive mice immunized with ProDer p 1 DNA developed Th1 immune responses characterized by high titres of specific IgG2a antibodies, low titres of specific IgG1 and, remarkably, the absence of anti-ProDer p 1 IgE. No specific responses were observed in animals vaccinated with the blank DNA vector. By contrast, natural Der p 1 or recombinant ProDer p 1 adsorbed to alum induced pronounced Th2 allergic responses with strong specific IgG1 and IgE titres. Spleen cells from DNA ProDer p 1-vaccinated mice secreted high levels of IFN-gamma and low production of IL-5. Conversely, both adjuvanted allergens stimulated typical Th2-type cytokine profile characterized by high and low levels of IL-5 and IFN-gamma, respectively. Whereas BAL eosinophilia was clearly observed in Der p 1-immunized animals, ProDer p 1 DNA as well as ProDer p 1 vaccinations prevented airway eosinophil infiltrations. CONCLUSIONS: These results suggest that vaccination with DNA encoding ProDer p 1 effectively fails to induce the allergen-induced IgE synthesis and airway cell infiltration. Plasmid DNA encoding ProDer p 1 may provide a novel approach for the treatment of house dust mite allergy.
JournalClin Exp Allergy. 33(2): 218-25.
SummaryThe authors wished to synthesize an alternative treatment to severe allergic reactions caused by exposure to Dermatophagoides pteronyssinus, European house dust mite. Older treatments involve progressive desensitization of individuals to increasing concentration of allergens, which even if performed correctly can have severe side effects like anaphylactic shock. Two DNA vaccines were developed from both natural ProDer p1 and recoded ProDer p 1. The authors wished to introduce these gene into an organism and shift immune response from a Th2 to a Th1 pathway, reducing or eliminating allergic reaction. Mice were exposed to the wild-type gene by injection of DNA on the pJW4304 plasmid and naked DNA and to the recoded gene on the plasmid. Mice were treated with both genes and eventually subjected to a crude mite extract challenge. These mice were then sacrificed for analysis of their BAL and antibodies. Interestingly, mice injected with naked wild-type DNA showed the least allergic response to the challenge of the three groups.
Comments
Discussion
PubMed ID12580915
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site