Synthetic Gene DataBase
 

Synthetic Gene 240


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID215240
GenBank AccessionAY988601AY816748
GenBank GI6627189256159075
Gene NameNiV-FNiV-Fopt
Gene Length (bp)23431659
SpeciesNipah VirusHomo sapiens
StrainsBangladesh293T
CDSaggagccaagctctcgcctttttcaaaaaattaaacaagcattattactatctgatcaac
aaaaggattggtttaatcatctaagaaatctctcgaaagacaaagagattctaggtttta
tgttgaaggaagtgtgttaaacctaggagacccttcaacagtcaggtcgcgggaatacaa
acaaagacaaaaacaaaaataaaattgattctgtcagaagattcattccaaaaagtgacc
aaatcaaagcagttggtagacctatcaatcatatcccgtaagactcgacaatggcagtta
tacttaacaagagatattattctaatctcttaatactgattttgatgatctcggagtgca
gtgtcgggattttgcattatgagaaattgagtaagattgggcttgtcaaaggaataacaa
gaaaatacaagatcaaaagcaatcctctcacaaaagacattgttattaaaatgattccga
atgtgtcaaacatgtctcaatgcacggggagtgtcatggaaaattataaaacacgattaa
acggtatcctaacgcctataaagggggcattagagatttacaagaacaacactcatgacc
ttgtcggtgatgtaagactggccggagttataatggcaggagttgctattggaattgcaa
ccgcagctcaaattactgcaggtgtagcattatatgaggcaatgaaaaatgctgacaaca
tcaacaaactcaaaagcagcatagaatcaactaatgaagctgttgttaagcttcaagaga
ctgcagaaaagacagtctatgtactgaccgctttgcaggattacattaatactaacttgg
taccgacaattgacaagataagctgcaaacagacggaactctcattagatctagcactat
caaagtactcctctgatttgctttttgtatttggtcccaaccttcaagacccagtttcta
attcaatgactatacaggctatatctcaggcattcggtggaaattatgaaacactgctaa
gaacgttgggttacgctacagaaggctttgatgatcttctagaaagtgacagcataacgg
gtcaaattatctacgttgatttaagtggctactacataattgtcagggtttattttccta
tcctgactgaaatccaacaggcctatatccaagaattgttgccagtgagctttaacaatg
acaattcagaatggatcagcattgtcccaaatttcatattggtaaggaacacattaatat
caaatatagagattggattttgcctaattacaaagaggagtgtgatctgcaaccaagatt
atgcaacacccatgacaaacaatatgagggaatgtttgacggggtcgactgagaagtgtc
ctcgagagctggttgtttcatcacacgttcccagatttgcactatctaacggggttttgt
ttgctaattgcataagcgtcacatgccagtgtcaaacaacaggtagggcaatctcacagt
caggagaacaaactctgctaatgattgataacaccacctgtcctacagctgtactcggta
atgtgatcatcagcttggggaaatatcttgggtcagtaaattataactctgaaggcattg
ctattggtcctcctgtctttactgataaagttgacatatcaagtcaaatatctagcatga
atcagtccttacaacaatctaaggactatatcaaagaagctcaacgactccttgatactg
ttaacccgtcattaataagcatgttgtctatgatcatactgtatgtactatcaattgcat
cattgtgtataggattgattacatttatcagttttatcattgttgagaaaaaaagaaaca
cctatagcagattagaggacaggagagtcagacctacaagtagtggggatctctattaca
ttgggacgtagtgtattcagattgattgaattacatcaaagagatcaaaggacttctaat
tttcagaaatggattgtatgtaattgattagatcatcttggatacttgagataggaatgt
tgcaactttaaaattaaaccatgtaaataattgtgacaaattataagtttctttcatttt
cttaaagtaataatttgatgaatatacaatatattctctcgcaagagctctaatctatac
actccctcctaatattttatactcataattaatgatatgatgataaataaagattcaaat
tgacttatgatataatttcatactataacaacatctcaaccaaggaaatgtacttgcaat
tatacattgtactcaaccatgaatgaacagttgatattctttttttgaaaaaattataaa
aaa
atggtggtgatcctggacaagcggtgctactgcaacctgctgatcctgatcctgatgatc
agcgagtgcagcgtgggcatcctgcactacgagaagctgagcaagatcggcctggtgaag
ggcgtgacccggaagtacaagatcaagagcaaccccctgaccaaggacatcgtgatcaag
atgatccccaacgtgagcaacatgagccagtgcaccggcagcgtgatggagaactacaag
acccggctgaacggcatcctgacccccatcaagggcgccctggagatctacaagaacaac
acccacgacctggtgggcgacgtgcggctggccggcgtgatcatggccggcgtggccatc
ggcatcgccacagccgcccagatcaccgccggagtggccctgtacgaggccatgaagaac
gccgacaacatcaacaagctgaagagcagcatcgagagcaccaacgaggccgtggtgaag
ctgcaggagaccgccgagaaaaccgtgtacgtgctgaccgccctgcaggactacatcaac
accaacctggtgcccaccatcgacaagatcagctgcaagcagaccgagctgagcctggac
ctggccctgagcaagtacctgagcgacctgctgttcgtgttcggccccaacctgcaggac
cccgtgagcaacagcatgaccatccaggccatcagccaggccttcggcggcaactacgag
accctgctgcggaccctgggctacgccaccgaggacttcgacgacctgctggagagcgac
agcatcaccggccagatcatctacgtggacctgagcagctactacatcatcgtgcgggtg
tacttccccatcctgaccgagatccagcaggcctacatccaggagctgctgcccgtgagc
ttcaacaacgacaacagcgagtggatcagcatcgtgcccaacttcatcctggtgcggaac
accctgatcagcaacatcgagatcggcttctgcctgatcaccaagcggagcgtgatctgc
aaccaggactacgccacccccatgaccaacaacatgcgggagtgcctgaccggcagcacc
gagaagtgccccagggagctggtggtgagcagccacgtgccccggttcgccctgagcaac
ggcgtgctgttcgccaactgcatcagcgtgacctgccagtgccagaccaccggcagagcc
atcagccagagcggcgagcagaccctgctgatgatcgacaacaccacctgccccaccgcc
gtgctgggcaacgtgatcatcagcctgggcaagtatctgggcagcgtgaactacaacagc
gagggcatcgccatcggccctcccgtgttcaccgacaaggtggacatcagcagccagatc
agcagcatgaaccagagcctgcagcagagcaaggattacatcaaggaggcccagcggctg
ctggacaccgtgaaccccagcctgatcagcatgctgtccatgatcatcctgtacgtgctg
agcatcgccagcctgtgcatcggcctgatcaccttcatcagcttcatcatcgtggagaag
aagcggaacacctacagccggctggaggaccggcgggtgcggcccaccagcagcggcgac
ctgtactacatcggcaccgacacctaccggtacatctaa
5' End
3' End
Notestagged at C-terminus with AU1 sequence
Expression VectorpcNiV-Fopt
Assay Methodslectin-binding assay
ResultsNo result of wild-type gene were produced. Focus of the paper is on immune response and gal-1 determining function.Lectins GNV, PHA-E, and PNA were used to bind protein product F. In increasing order of affinity (in arbitrary densitometric units) GNV
Protein Functioncell mediated fusion
Recoding PurposeTo improve expression
Synthesized ByGeneart
Recoding MethodGeneart recoded the gene using a proprietary software accounting for codon usage and secondary
DNA/RNA structures as well as eliminating cryptic splice sites.
Publication Author(s)Levroney EL, Aguilar HC, Fulcher JA, Kohatsu L, Pace KE, Pang M, Gurney KB, Baum LG, Lee B.
Corresponding AuthorLinda G. Baum
Corresponding AddressDepartment of Microbiology, Immunology, and Molecular Genetics, David Geffen School of Medicine at University of California, Los Angeles, CA 90095, USA.
Publication Year2005
Publication TitleNovel innate immune functions for galectin-1: galectin-1 inhibits cell fusion by Nipah virus envelope glycoproteins and augments dendritic cell secretion of proinflammatory cytokines.
AbstractGalectin-1 (gal-1), an endogenous lectin secreted by a variety of cell types, has pleiotropic immunomodulatory functions, including regulation of lymphocyte survival and cytokine secretion in autoimmune, transplant disease, and parasitic infection models. However, the role of gal-1 in viral infections is unknown. Nipah virus (NiV) is an emerging pathogen that causes severe, often fatal, febrile encephalitis. The primary targets of NiV are endothelial cells. NiV infection of endothelial cells results in cell-cell fusion and syncytia formation triggered by the fusion (F) and attachment (G) envelope glycoproteins of NiV that bear glycan structures recognized by gal-1. In the present study, we report that NiV envelope-mediated cell-cell fusion is blocked by gal-1. This inhibition is specific to the Paramyxoviridae family because gal-1 did not inhibit fusion triggered by envelope glycoproteins of other viruses, including two retroviruses and a pox virus, but inhibited fusion triggered by envelope glycoproteins of the related Hendra virus and another paramyxovirus. The physiologic dimeric form of gal-1 is required for fusion inhibition because a monomeric gal-1 mutant had no inhibitory effect on cell fusion. gal-1 binds to specific N-glycans on NiV glycoproteins and aberrantly oligomerizes NiV-F and NiV-G, indicating a mechanism for fusion inhibition. gal-1 also increases dendritic cell production of proinflammatory cytokines such as IL-6, known to be protective in the setting of other viral diseases such as Ebola infections. Thus, gal-1 may have direct antiviral effects and may also augment the innate immune response against this emerging pathogen.
JournalJ Immunol.. 175(1): 413-20.
SummaryThe authors wish to find out more about the effect synthetic galectin-1 will have on Nipah Virus mediated cell fusion and the human immune system. The genes of interest, which are sufficient for the formation the syncytia, were recoding for the purposes of the experiment. Recoding was left to Geneart, who used a proprietary software to recode the gene, accounting for codon usage and secondary DNA/RNA structures as well as eliminating cryptic splice sites. The lectin-binding assay was a semiquantitative was not conclusive in the amount of protein expressed by either of the optimized genes. Furthermore, improvement in expression cannot be determined as no wild-type plasmids were constructed for transfection.
CommentsThis is not a paper about codon optimization.
Discussion
PubMed ID15972675
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site